Incidental Mutation 'R8051:Chtf18'
ID619071
Institutional Source Beutler Lab
Gene Symbol Chtf18
Ensembl Gene ENSMUSG00000019214
Gene NameCTF18, chromosome transmission fidelity factor 18
Synonyms6030457M03Rik, CTF18
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.479) question?
Stock #R8051 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location25718926-25727419 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 25723479 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 462 (V462L)
Ref Sequence ENSEMBL: ENSMUSP00000043896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047273] [ENSMUST00000048054] [ENSMUST00000115108] [ENSMUST00000167940] [ENSMUST00000170070] [ENSMUST00000170575] [ENSMUST00000172002]
Predicted Effect probably benign
Transcript: ENSMUST00000047273
SMART Domains Protein: ENSMUSP00000043825
Gene: ENSMUSG00000041199

DomainStartEndE-ValueType
Pfam:PseudoU_synth_2 17 182 4.1e-27 PFAM
low complexity region 271 287 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000048054
AA Change: V462L

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000043896
Gene: ENSMUSG00000019214
AA Change: V462L

DomainStartEndE-ValueType
low complexity region 20 30 N/A INTRINSIC
low complexity region 73 84 N/A INTRINSIC
low complexity region 117 130 N/A INTRINSIC
low complexity region 154 168 N/A INTRINSIC
coiled coil region 228 255 N/A INTRINSIC
low complexity region 299 310 N/A INTRINSIC
low complexity region 343 354 N/A INTRINSIC
AAA 361 518 1.99e-11 SMART
low complexity region 646 661 N/A INTRINSIC
Blast:AAA 728 850 7e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000115108
SMART Domains Protein: ENSMUSP00000110760
Gene: ENSMUSG00000025739

DomainStartEndE-ValueType
G_gamma 3 67 1.32e-16 SMART
GGL 6 67 2.09e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167940
SMART Domains Protein: ENSMUSP00000131349
Gene: ENSMUSG00000019214

DomainStartEndE-ValueType
low complexity region 8 20 N/A INTRINSIC
Blast:AAA 21 107 9e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000169767
Predicted Effect probably benign
Transcript: ENSMUST00000170070
SMART Domains Protein: ENSMUSP00000131768
Gene: ENSMUSG00000019214

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
low complexity region 74 85 N/A INTRINSIC
low complexity region 118 131 N/A INTRINSIC
low complexity region 155 169 N/A INTRINSIC
coiled coil region 229 256 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170575
SMART Domains Protein: ENSMUSP00000131366
Gene: ENSMUSG00000019214

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
low complexity region 74 85 N/A INTRINSIC
low complexity region 118 131 N/A INTRINSIC
low complexity region 155 169 N/A INTRINSIC
coiled coil region 229 256 N/A INTRINSIC
low complexity region 300 311 N/A INTRINSIC
low complexity region 344 355 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172002
SMART Domains Protein: ENSMUSP00000131648
Gene: ENSMUSG00000025739

DomainStartEndE-ValueType
G_gamma 3 67 1.32e-16 SMART
GGL 6 67 2.09e-9 SMART
Meta Mutation Damage Score 0.1186 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is a component of a replication factor C (RFC) complex, which loads proliferating cell nuclear antigen (PCNA) on to DNA during the S phase of cell cycle. The encoded protein may interact with other proteins, including RFC complex 3, to form a clamp loader complex that plays a role in sister chromatid cohesion during metaphase-anaphase transition. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial prenatal lethality, reduced body and testis weight, defective male meiosis, impaired spermatogenesis, oligozoospermia, and reduced male fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik G A 11: 78,273,412 probably benign Het
Acan T A 7: 79,100,779 L1766Q probably damaging Het
Adgrl3 A G 5: 81,465,266 Y114C probably damaging Het
Ano9 T A 7: 141,104,532 I472F probably damaging Het
Arhgap10 A G 8: 77,517,680 F35S probably damaging Het
Btnl2 T A 17: 34,363,499 D346E probably damaging Het
C4bp A T 1: 130,655,968 C88S probably damaging Het
Cavin2 A T 1: 51,301,124 Q320L probably benign Het
Crisp3 A T 17: 40,232,560 S134R probably benign Het
Dlg4 C A 11: 70,031,642 probably benign Het
Dsc3 A T 18: 19,981,213 M328K probably damaging Het
Efemp2 T A 19: 5,476,067 D73E probably damaging Het
Fbn1 C T 2: 125,306,463 A2622T possibly damaging Het
Flt1 T C 5: 147,582,691 H938R probably benign Het
Flt3 T G 5: 147,358,955 probably benign Het
Fnbp4 T C 2: 90,777,739 V935A possibly damaging Het
Frem2 T C 3: 53,535,355 N2587S probably benign Het
Gabbr2 C T 4: 46,736,349 probably null Het
Gm36864 A T 7: 44,242,552 I385F probably benign Het
Il17re G T 6: 113,459,367 R47L probably benign Het
Il27ra A G 8: 84,033,949 probably null Het
Irf4 A G 13: 30,761,473 I401V probably damaging Het
Kat6a T C 8: 22,910,249 L342S probably damaging Het
Klc1 T A 12: 111,781,950 C390S possibly damaging Het
Klhl22 A T 16: 17,792,579 I565F probably damaging Het
Krt26 A T 11: 99,337,846 L20Q probably damaging Het
Lamb3 T C 1: 193,330,067 V384A possibly damaging Het
Lmo2 T A 2: 103,970,700 L80Q possibly damaging Het
Lrrc37a T G 11: 103,503,126 E491A possibly damaging Het
Ninj1 T A 13: 49,193,812 M51K probably damaging Het
Olfr109 G A 17: 37,466,322 G39R probably damaging Het
Olfr742 C A 14: 50,515,643 N146K probably benign Het
Plppr3 T A 10: 79,867,004 T142S probably damaging Het
Rab2b T C 14: 52,268,696 D103G probably damaging Het
Rap1gap2 G T 11: 74,395,825 R550S probably damaging Het
Rbm33 A G 5: 28,352,625 N279D probably damaging Het
Rhox9 C T X: 37,901,376 G40R probably benign Het
Selplg G A 5: 113,819,441 T268I probably damaging Het
Slc20a1 T C 2: 129,208,200 M426T possibly damaging Het
Spata18 A T 5: 73,669,720 Y220F Het
Spns1 T C 7: 126,372,536 T281A probably benign Het
Sptan1 C T 2: 30,030,159 R2288C probably damaging Het
Tacstd2 T C 6: 67,535,399 D103G probably damaging Het
Tmem121 C T 12: 113,188,867 A235V probably benign Het
Try4 A G 6: 41,305,062 D194G probably damaging Het
Tyrp1 C A 4: 80,837,660 T222K probably damaging Het
Zfp57 T A 17: 37,009,893 V213D probably damaging Het
Zfy2 A T Y: 2,117,380 probably benign Het
Zkscan4 G A 13: 21,484,653 G454R not run Het
Other mutations in Chtf18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00973:Chtf18 APN 17 25722116 missense probably benign 0.32
IGL02117:Chtf18 APN 17 25722203 missense possibly damaging 0.63
IGL03034:Chtf18 APN 17 25727346 utr 5 prime probably benign
IGL03051:Chtf18 APN 17 25720964 missense probably damaging 1.00
IGL03164:Chtf18 APN 17 25726842 missense probably benign 0.24
R0046:Chtf18 UTSW 17 25723460 missense probably benign 0.06
R0129:Chtf18 UTSW 17 25727311 nonsense probably null
R1122:Chtf18 UTSW 17 25724623 missense probably damaging 1.00
R1302:Chtf18 UTSW 17 25719158 missense probably damaging 1.00
R1487:Chtf18 UTSW 17 25720609 missense probably benign 0.00
R1614:Chtf18 UTSW 17 25727090 missense probably benign 0.00
R1820:Chtf18 UTSW 17 25725939 missense probably damaging 1.00
R4051:Chtf18 UTSW 17 25719194 missense probably damaging 0.98
R4357:Chtf18 UTSW 17 25719132 missense probably benign 0.09
R4529:Chtf18 UTSW 17 25720618 missense probably damaging 1.00
R4804:Chtf18 UTSW 17 25719257 missense probably benign
R4975:Chtf18 UTSW 17 25724566 missense possibly damaging 0.72
R5154:Chtf18 UTSW 17 25723720 missense probably damaging 1.00
R6113:Chtf18 UTSW 17 25722867 missense probably damaging 1.00
R6118:Chtf18 UTSW 17 25719159 missense probably damaging 1.00
R6446:Chtf18 UTSW 17 25721244 missense probably benign 0.01
R7057:Chtf18 UTSW 17 25721126 missense possibly damaging 0.49
R7095:Chtf18 UTSW 17 25722678 missense probably damaging 1.00
R7482:Chtf18 UTSW 17 25719989 missense possibly damaging 0.48
R7641:Chtf18 UTSW 17 25722275 intron probably null
R7729:Chtf18 UTSW 17 25723517 missense probably damaging 1.00
R7939:Chtf18 UTSW 17 25722137 missense probably damaging 0.99
R8007:Chtf18 UTSW 17 25725534 missense probably damaging 0.96
R8296:Chtf18 UTSW 17 25722191 missense probably benign 0.00
R8321:Chtf18 UTSW 17 25720891 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- AGGTGTGAACCTGCAGAAC -3'
(R):5'- CGCAAATGGAGTCGGTTCTG -3'

Sequencing Primer
(F):5'- CAGAACAGGACCTGCGGTG -3'
(R):5'- CCAACTGCCTGGTTATTGATGAGATC -3'
Posted On2020-01-23