Incidental Mutation 'R8052:Tns1'
ID619082
Institutional Source Beutler Lab
Gene Symbol Tns1
Ensembl Gene ENSMUSG00000055322
Gene Nametensin 1
Synonyms1110018I21Rik, 1200014E20Rik, E030018G17Rik, E030037J05Rik, Tns
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.445) question?
Stock #R8052 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location73910231-74124449 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 73953437 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 67 (D67V)
Ref Sequence ENSEMBL: ENSMUSP00000140991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169786] [ENSMUST00000187584] [ENSMUST00000191104] [ENSMUST00000191367] [ENSMUST00000212888]
Predicted Effect probably damaging
Transcript: ENSMUST00000169786
AA Change: D694V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127715
Gene: ENSMUSG00000055322
AA Change: D694V

DomainStartEndE-ValueType
low complexity region 15 33 N/A INTRINSIC
C1 62 108 1.77e-2 SMART
low complexity region 154 167 N/A INTRINSIC
SCOP:d1d5ra2 176 348 3e-32 SMART
PTEN_C2 350 477 1.12e-51 SMART
low complexity region 822 833 N/A INTRINSIC
low complexity region 905 922 N/A INTRINSIC
low complexity region 1227 1239 N/A INTRINSIC
low complexity region 1284 1300 N/A INTRINSIC
low complexity region 1459 1470 N/A INTRINSIC
low complexity region 1518 1530 N/A INTRINSIC
SH2 1614 1716 6.85e-17 SMART
PTB 1747 1888 1.69e-29 SMART
Predicted Effect
Predicted Effect
Predicted Effect probably damaging
Transcript: ENSMUST00000187584
AA Change: D650V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140254
Gene: ENSMUSG00000055322
AA Change: D650V

DomainStartEndE-ValueType
C1 21 67 8.6e-5 SMART
low complexity region 113 124 N/A INTRINSIC
PTPc_DSPc 197 319 9.9e-6 SMART
PTEN_C2 306 433 5.6e-56 SMART
low complexity region 778 789 N/A INTRINSIC
low complexity region 861 878 N/A INTRINSIC
low complexity region 1162 1174 N/A INTRINSIC
low complexity region 1219 1235 N/A INTRINSIC
low complexity region 1394 1405 N/A INTRINSIC
low complexity region 1453 1465 N/A INTRINSIC
SH2 1549 1651 4.3e-19 SMART
PTB 1682 1823 9e-32 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000191104
AA Change: D694V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140317
Gene: ENSMUSG00000055322
AA Change: D694V

DomainStartEndE-ValueType
low complexity region 15 33 N/A INTRINSIC
C1 62 108 8.6e-5 SMART
low complexity region 154 167 N/A INTRINSIC
PTPc_DSPc 241 363 9.9e-6 SMART
PTEN_C2 350 477 5.6e-56 SMART
low complexity region 822 833 N/A INTRINSIC
low complexity region 905 922 N/A INTRINSIC
low complexity region 1206 1218 N/A INTRINSIC
low complexity region 1263 1279 N/A INTRINSIC
low complexity region 1438 1449 N/A INTRINSIC
low complexity region 1497 1509 N/A INTRINSIC
SH2 1593 1695 4.3e-19 SMART
PTB 1726 1867 9e-32 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000191367
AA Change: D67V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000212888
AA Change: D694V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene localizes to focal adhesions, regions of the plasma membrane where the cell attaches to the extracellular matrix. This protein crosslinks actin filaments and contains a Src homology 2 (SH2) domain, which is often found in molecules involved in signal transduction. This protein is a substrate of calpain II. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced female fertility, and develop kidney cysts and progressive kidney degeneration that may lead to death from renal failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik TCC TCCGCC 6: 96,165,097 probably benign Het
1700123L14Rik TCC TCCCCC 6: 96,165,103 probably benign Het
2010111I01Rik G A 13: 63,068,251 V446I probably damaging Het
Abi1 T C 2: 22,953,543 T297A probably benign Het
Acadl G T 1: 66,853,178 T162K probably benign Het
Aldoart2 A T 12: 55,565,751 I154F probably damaging Het
Alkbh8 G A 9: 3,385,478 R625H probably damaging Het
Ankrd31 T A 13: 96,832,528 V891E probably benign Het
Atp8b5 C T 4: 43,356,982 R577* probably null Het
Capn3 G T 2: 120,486,386 E285D probably benign Het
Cd79b G T 11: 106,313,700 P87T probably damaging Het
Celsr2 T G 3: 108,412,655 D947A probably damaging Het
Csmd3 A C 15: 47,706,387 S1213R Het
Cyp2j5 T C 4: 96,664,004 M3V probably benign Het
Ddi1 C T 9: 6,265,787 R194K probably benign Het
Decr1 T C 4: 15,933,019 K49R probably benign Het
Dnah10 A C 5: 124,828,511 E4130A probably benign Het
Dst A G 1: 34,284,363 D4648G probably damaging Het
Ecd A G 14: 20,329,952 probably null Het
Erbin A T 13: 103,834,356 Y917* probably null Het
Evpl T C 11: 116,223,163 K1234E probably benign Het
F11r T A 1: 171,461,623 Y218N possibly damaging Het
Fam43a C G 16: 30,601,804 T402S probably benign Het
Frem2 T C 3: 53,549,643 N2096S probably benign Het
Gm7697 A T 8: 69,522,752 Y21N possibly damaging Het
Gpd2 T A 2: 57,306,950 Y172* probably null Het
Hscb A G 5: 110,835,978 V90A probably benign Het
Iqgap2 T C 13: 95,657,879 D1195G probably damaging Het
Map2k2 T C 10: 81,115,066 I115T probably damaging Het
Mast2 C T 4: 116,312,975 R707H probably damaging Het
Mindy4 A G 6: 55,300,992 N607S probably damaging Het
Mrpl9 T A 3: 94,443,743 Y77N probably damaging Het
Muc16 G A 9: 18,659,051 T724I unknown Het
Nat3 A T 8: 67,547,826 Y119F possibly damaging Het
Nol7 T C 13: 43,401,514 S208P probably damaging Het
Notch3 A T 17: 32,146,571 C1056S probably damaging Het
Olfr1039 A T 2: 86,131,377 Y95* probably null Het
Olfr146 G T 9: 39,019,487 T18K probably damaging Het
Olfr399 T A 11: 74,054,475 I95F probably benign Het
Olfr71 A T 4: 43,705,884 V228E probably damaging Het
Osbpl3 A C 6: 50,346,015 L288R probably damaging Het
Oscp1 A C 4: 126,088,323 D352A possibly damaging Het
Pcdh9 G A 14: 93,885,786 R983C probably benign Het
Pcdhgb8 T C 18: 37,763,502 S542P probably benign Het
Pi4ka T C 16: 17,356,166 T490A Het
Pkd1l1 A T 11: 8,947,315 D531E Het
Prr3 G T 17: 35,979,161 D26E possibly damaging Het
Psmd8 T C 7: 29,180,576 K24E probably benign Het
Rasgrp4 G A 7: 29,149,937 C583Y probably damaging Het
Rest A G 5: 77,268,324 I128M probably benign Het
Rftn1 A T 17: 50,086,579 F144I probably damaging Het
Rusc2 T C 4: 43,421,851 F757S probably benign Het
Ryr1 A G 7: 29,083,385 S1942P probably benign Het
Sdk2 C T 11: 113,854,351 R706Q probably damaging Het
Sergef G T 7: 46,614,638 T275K probably damaging Het
Serpina10 T C 12: 103,628,310 T217A probably damaging Het
Shd G C 17: 55,976,235 S288T probably damaging Het
Siglec15 C A 18: 78,048,588 A133S possibly damaging Het
Stat4 C T 1: 52,079,773 P325L probably damaging Het
Syt8 G A 7: 142,440,144 G344D probably damaging Het
Tes A G 6: 17,097,292 E133G probably benign Het
Tmprss2 T C 16: 97,568,416 Y386C probably damaging Het
Tnfrsf11b A T 15: 54,252,106 L365Q probably damaging Het
Tns2 T C 15: 102,112,845 S982P probably damaging Het
Tpcn2 A T 7: 145,260,946 F473I probably benign Het
Tsg101 A T 7: 46,892,509 I232N probably damaging Het
Ttc3 T C 16: 94,467,989 S1977P probably benign Het
Ttll11 T A 2: 35,979,515 E37V unknown Het
Ttn A T 2: 76,818,816 V12716E possibly damaging Het
Vmn2r70 A C 7: 85,563,715 S495A probably benign Het
Zfp974 A G 7: 27,911,272 C343R probably damaging Het
Zfy1 A T Y: 726,004 I587N possibly damaging Het
Other mutations in Tns1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00954:Tns1 APN 1 73924969 missense probably damaging 0.99
IGL01288:Tns1 APN 1 73953810 missense probably damaging 1.00
IGL01536:Tns1 APN 1 73919648 splice site probably benign
IGL01568:Tns1 APN 1 73953509 missense probably damaging 1.00
IGL01683:Tns1 APN 1 73953269 missense probably damaging 0.98
IGL02267:Tns1 APN 1 73992131 missense possibly damaging 0.95
IGL02597:Tns1 APN 1 73985873 critical splice donor site probably null
IGL02819:Tns1 APN 1 73937248 missense probably damaging 0.99
IGL03370:Tns1 APN 1 73985894 missense probably damaging 1.00
R0087:Tns1 UTSW 1 73916917 missense possibly damaging 0.95
R0207:Tns1 UTSW 1 73937318 critical splice acceptor site probably null
R0411:Tns1 UTSW 1 73925761 missense probably damaging 0.96
R0543:Tns1 UTSW 1 73952697 missense probably benign 0.01
R0552:Tns1 UTSW 1 73920563 missense probably damaging 1.00
R0720:Tns1 UTSW 1 73925581 missense probably benign 0.03
R0828:Tns1 UTSW 1 73919666 missense probably damaging 1.00
R1034:Tns1 UTSW 1 73941969 missense probably damaging 1.00
R1061:Tns1 UTSW 1 73917672 missense probably damaging 1.00
R1819:Tns1 UTSW 1 73916476 splice site probably benign
R1826:Tns1 UTSW 1 73953634 start codon destroyed probably null 0.91
R2208:Tns1 UTSW 1 74079240 missense probably damaging 1.00
R3723:Tns1 UTSW 1 73924940 missense probably damaging 0.99
R4079:Tns1 UTSW 1 73995308 missense probably damaging 1.00
R4111:Tns1 UTSW 1 73941932 missense probably damaging 1.00
R4155:Tns1 UTSW 1 73914631 missense probably damaging 1.00
R4156:Tns1 UTSW 1 73914631 missense probably damaging 1.00
R4157:Tns1 UTSW 1 73914631 missense probably damaging 1.00
R4274:Tns1 UTSW 1 73928098 missense probably damaging 1.00
R4426:Tns1 UTSW 1 73985749 missense probably damaging 0.97
R4649:Tns1 UTSW 1 73953771 missense probably damaging 1.00
R4742:Tns1 UTSW 1 74124290 critical splice donor site probably null
R4869:Tns1 UTSW 1 73952615 missense probably benign
R4961:Tns1 UTSW 1 73935915 missense probably benign 0.35
R5025:Tns1 UTSW 1 73925482 missense probably damaging 1.00
R5035:Tns1 UTSW 1 73953820 start gained probably benign
R5062:Tns1 UTSW 1 73952864 missense probably damaging 1.00
R5080:Tns1 UTSW 1 73952940 missense probably damaging 1.00
R5213:Tns1 UTSW 1 73953612 missense probably damaging 1.00
R5256:Tns1 UTSW 1 73995426 intron probably benign
R5368:Tns1 UTSW 1 73941017 missense probably benign 0.07
R5391:Tns1 UTSW 1 73990409 splice site probably null
R5587:Tns1 UTSW 1 73920596 missense possibly damaging 0.94
R5735:Tns1 UTSW 1 73927979 missense probably benign 0.00
R5855:Tns1 UTSW 1 73918033 missense possibly damaging 0.83
R5999:Tns1 UTSW 1 73928097 nonsense probably null
R6122:Tns1 UTSW 1 73952419 critical splice donor site probably null
R6148:Tns1 UTSW 1 73953453 missense probably damaging 1.00
R6457:Tns1 UTSW 1 73918050 missense probably damaging 0.99
R6525:Tns1 UTSW 1 73953470 missense probably damaging 1.00
R6712:Tns1 UTSW 1 74079301 nonsense probably null
R6773:Tns1 UTSW 1 73919707 missense probably damaging 1.00
R6825:Tns1 UTSW 1 74002323 nonsense probably null
R7085:Tns1 UTSW 1 73925462 missense probably benign 0.00
R7128:Tns1 UTSW 1 73995304 missense
R7209:Tns1 UTSW 1 73953915 missense possibly damaging 0.68
R7348:Tns1 UTSW 1 73916917 missense possibly damaging 0.95
R7570:Tns1 UTSW 1 73953479 missense probably damaging 1.00
R7670:Tns1 UTSW 1 73952477 missense possibly damaging 0.93
R7769:Tns1 UTSW 1 73953371 missense probably damaging 0.99
R7833:Tns1 UTSW 1 74091331 intron probably benign
R8225:Tns1 UTSW 1 73985887 missense probably damaging 1.00
R8244:Tns1 UTSW 1 73937251 missense probably damaging 1.00
R8321:Tns1 UTSW 1 73985780 critical splice acceptor site probably null
R8344:Tns1 UTSW 1 73985042 missense probably damaging 1.00
R8378:Tns1 UTSW 1 73937246 missense probably damaging 1.00
Z1177:Tns1 UTSW 1 74002307 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- AACCCTCCTGAGCAGAGTAG -3'
(R):5'- AAAGCAAGGCGCCATGTACC -3'

Sequencing Primer
(F):5'- TCCTGAGCAGAGTAGGAGGGTC -3'
(R):5'- ATGTACCGGGCTCAGCAACTC -3'
Posted On2020-01-23