Incidental Mutation 'R8052:Or13j1'
ID 619096
Institutional Source Beutler Lab
Gene Symbol Or13j1
Ensembl Gene ENSMUSG00000046450
Gene Name olfactory receptor family 13 subfamily J member 1
Synonyms MOR262-4, Olfr71, mOR17, GA_x6K02T2N78B-16230286-16231224
MMRRC Submission 067489-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.079) question?
Stock # R8052 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 43705628-43706566 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 43705884 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 228 (V228E)
Ref Sequence ENSEMBL: ENSMUSP00000103494 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055401] [ENSMUST00000107862] [ENSMUST00000217544]
AlphaFold Q9QZ18
Predicted Effect probably damaging
Transcript: ENSMUST00000055401
AA Change: V228E

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000060230
Gene: ENSMUSG00000046450
AA Change: V228E

DomainStartEndE-ValueType
Pfam:7tm_1 41 290 2.4e-34 PFAM
Pfam:7tm_4 139 283 4.5e-44 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107862
AA Change: V228E

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103494
Gene: ENSMUSG00000046450
AA Change: V228E

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 2.2e-52 PFAM
Pfam:7tm_1 41 290 7.5e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000217544
AA Change: V228E

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi1 T C 2: 22,843,555 (GRCm39) T297A probably benign Het
Acadl G T 1: 66,892,337 (GRCm39) T162K probably benign Het
Aldoart2 A T 12: 55,612,536 (GRCm39) I154F probably damaging Het
Alkbh8 G A 9: 3,385,478 (GRCm39) R625H probably damaging Het
Ankrd31 T A 13: 96,969,036 (GRCm39) V891E probably benign Het
Aopep G A 13: 63,216,065 (GRCm39) V446I probably damaging Het
Atp8b5 C T 4: 43,356,982 (GRCm39) R577* probably null Het
Capn3 G T 2: 120,316,867 (GRCm39) E285D probably benign Het
Cd79b G T 11: 106,204,526 (GRCm39) P87T probably damaging Het
Celsr2 T G 3: 108,319,971 (GRCm39) D947A probably damaging Het
Csmd3 A C 15: 47,569,783 (GRCm39) S1213R Het
Cyp2j5 T C 4: 96,552,241 (GRCm39) M3V probably benign Het
Ddi1 C T 9: 6,265,787 (GRCm39) R194K probably benign Het
Decr1 T C 4: 15,933,019 (GRCm39) K49R probably benign Het
Dnah10 A C 5: 124,905,575 (GRCm39) E4130A probably benign Het
Dst A G 1: 34,323,444 (GRCm39) D4648G probably damaging Het
Ecd A G 14: 20,380,020 (GRCm39) probably null Het
Erbin A T 13: 103,970,864 (GRCm39) Y917* probably null Het
Evpl T C 11: 116,113,989 (GRCm39) K1234E probably benign Het
F11r T A 1: 171,289,191 (GRCm39) Y218N possibly damaging Het
Fam43a C G 16: 30,420,622 (GRCm39) T402S probably benign Het
Frem2 T C 3: 53,457,064 (GRCm39) N2096S probably benign Het
Gpd2 T A 2: 57,196,962 (GRCm39) Y172* probably null Het
Hscb A G 5: 110,983,844 (GRCm39) V90A probably benign Het
Iqgap2 T C 13: 95,794,387 (GRCm39) D1195G probably damaging Het
Map2k2 T C 10: 80,950,900 (GRCm39) I115T probably damaging Het
Mast2 C T 4: 116,170,172 (GRCm39) R707H probably damaging Het
Mindy4 A G 6: 55,277,977 (GRCm39) N607S probably damaging Het
Mrpl9 T A 3: 94,351,050 (GRCm39) Y77N probably damaging Het
Muc16 G A 9: 18,570,347 (GRCm39) T724I unknown Het
Nat3 A T 8: 68,000,478 (GRCm39) Y119F possibly damaging Het
Nol7 T C 13: 43,554,990 (GRCm39) S208P probably damaging Het
Notch3 A T 17: 32,365,545 (GRCm39) C1056S probably damaging Het
Nup50l TCC TCCGCC 6: 96,142,078 (GRCm39) probably benign Het
Nup50l TCC TCCCCC 6: 96,142,084 (GRCm39) probably benign Het
Or3a4 T A 11: 73,945,301 (GRCm39) I95F probably benign Het
Or5al5 A T 2: 85,961,721 (GRCm39) Y95* probably null Het
Or8g17 G T 9: 38,930,783 (GRCm39) T18K probably damaging Het
Osbpl3 A C 6: 50,322,995 (GRCm39) L288R probably damaging Het
Oscp1 A C 4: 125,982,116 (GRCm39) D352A possibly damaging Het
Pcdh9 G A 14: 94,123,222 (GRCm39) R983C probably benign Het
Pcdhgb8 T C 18: 37,896,555 (GRCm39) S542P probably benign Het
Pi4ka T C 16: 17,174,030 (GRCm39) T490A Het
Pkd1l1 A T 11: 8,897,315 (GRCm39) D531E Het
Potefam3d A T 8: 69,975,404 (GRCm39) Y21N possibly damaging Het
Prr3 G T 17: 36,290,053 (GRCm39) D26E possibly damaging Het
Psmd8 T C 7: 28,880,001 (GRCm39) K24E probably benign Het
Rasgrp4 G A 7: 28,849,362 (GRCm39) C583Y probably damaging Het
Rest A G 5: 77,416,171 (GRCm39) I128M probably benign Het
Rftn1 A T 17: 50,393,607 (GRCm39) F144I probably damaging Het
Rusc2 T C 4: 43,421,851 (GRCm39) F757S probably benign Het
Ryr1 A G 7: 28,782,810 (GRCm39) S1942P probably benign Het
Sdk2 C T 11: 113,745,177 (GRCm39) R706Q probably damaging Het
Sergef G T 7: 46,264,062 (GRCm39) T275K probably damaging Het
Serpina10 T C 12: 103,594,569 (GRCm39) T217A probably damaging Het
Shd G C 17: 56,283,235 (GRCm39) S288T probably damaging Het
Siglec15 C A 18: 78,091,803 (GRCm39) A133S possibly damaging Het
Stat4 C T 1: 52,118,932 (GRCm39) P325L probably damaging Het
Syt8 G A 7: 141,993,881 (GRCm39) G344D probably damaging Het
Tes A G 6: 17,097,291 (GRCm39) E133G probably benign Het
Tmprss2 T C 16: 97,369,616 (GRCm39) Y386C probably damaging Het
Tnfrsf11b A T 15: 54,115,502 (GRCm39) L365Q probably damaging Het
Tns1 T A 1: 73,992,596 (GRCm39) D67V probably damaging Het
Tns2 T C 15: 102,021,280 (GRCm39) S982P probably damaging Het
Tpcn2 A T 7: 144,814,683 (GRCm39) F473I probably benign Het
Tsg101 A T 7: 46,542,257 (GRCm39) I232N probably damaging Het
Ttc3 T C 16: 94,268,848 (GRCm39) S1977P probably benign Het
Ttll11 T A 2: 35,869,527 (GRCm39) E37V unknown Het
Ttn A T 2: 76,649,160 (GRCm39) V12716E possibly damaging Het
Vmn2r70 A C 7: 85,212,923 (GRCm39) S495A probably benign Het
Zfp974 A G 7: 27,610,697 (GRCm39) C343R probably damaging Het
Zfy1 A T Y: 726,004 (GRCm39) I587N possibly damaging Het
Other mutations in Or13j1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02317:Or13j1 APN 4 43,706,172 (GRCm39) missense probably damaging 1.00
PIT4453001:Or13j1 UTSW 4 43,706,464 (GRCm39) missense probably damaging 1.00
R0597:Or13j1 UTSW 4 43,706,592 (GRCm39) splice site probably null
R0610:Or13j1 UTSW 4 43,706,400 (GRCm39) missense possibly damaging 0.69
R1588:Or13j1 UTSW 4 43,705,923 (GRCm39) missense probably damaging 0.98
R1619:Or13j1 UTSW 4 43,706,292 (GRCm39) missense probably damaging 1.00
R1779:Or13j1 UTSW 4 43,706,041 (GRCm39) missense probably damaging 1.00
R2871:Or13j1 UTSW 4 43,706,458 (GRCm39) missense probably benign 0.30
R2871:Or13j1 UTSW 4 43,706,458 (GRCm39) missense probably benign 0.30
R4723:Or13j1 UTSW 4 43,705,785 (GRCm39) missense probably damaging 1.00
R4891:Or13j1 UTSW 4 43,706,194 (GRCm39) missense probably damaging 0.99
R5049:Or13j1 UTSW 4 43,706,259 (GRCm39) missense probably damaging 1.00
R5151:Or13j1 UTSW 4 43,706,518 (GRCm39) missense probably damaging 0.99
R5491:Or13j1 UTSW 4 43,705,990 (GRCm39) missense probably damaging 1.00
R5521:Or13j1 UTSW 4 43,705,788 (GRCm39) missense possibly damaging 0.88
R6225:Or13j1 UTSW 4 43,705,698 (GRCm39) missense probably damaging 1.00
R6518:Or13j1 UTSW 4 43,706,334 (GRCm39) missense probably benign 0.05
R6883:Or13j1 UTSW 4 43,705,723 (GRCm39) missense possibly damaging 0.93
R7185:Or13j1 UTSW 4 43,706,082 (GRCm39) missense possibly damaging 0.82
R7339:Or13j1 UTSW 4 43,706,080 (GRCm39) missense probably benign 0.05
R7502:Or13j1 UTSW 4 43,706,316 (GRCm39) missense probably damaging 0.97
R8797:Or13j1 UTSW 4 43,706,455 (GRCm39) missense probably damaging 1.00
R9701:Or13j1 UTSW 4 43,705,793 (GRCm39) missense probably benign 0.00
X0017:Or13j1 UTSW 4 43,705,990 (GRCm39) missense probably damaging 1.00
X0021:Or13j1 UTSW 4 43,706,326 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TAGATAATGGGGTTCAGCATGG -3'
(R):5'- TCAAGTCAGTGGCAGAGACG -3'

Sequencing Primer
(F):5'- TTCAGCATGGGGGTCACCAC -3'
(R):5'- TCAGTGGCAGAGACGGTCATC -3'
Posted On 2020-01-23