Incidental Mutation 'R8052:Rest'
ID 619100
Institutional Source Beutler Lab
Gene Symbol Rest
Ensembl Gene ENSMUSG00000029249
Gene Name RE1-silencing transcription factor
Synonyms NRSF, 2610008J04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8052 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 77265491-77286432 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 77268324 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Methionine at position 128 (I128M)
Ref Sequence ENSEMBL: ENSMUSP00000079231 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080359] [ENSMUST00000113449]
AlphaFold Q8VIG1
Predicted Effect probably benign
Transcript: ENSMUST00000080359
AA Change: I128M

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000079231
Gene: ENSMUSG00000029249
AA Change: I128M

DomainStartEndE-ValueType
low complexity region 85 95 N/A INTRINSIC
ZnF_C2H2 154 176 1.53e-1 SMART
ZnF_C2H2 211 233 4.23e0 SMART
ZnF_C2H2 243 265 2.53e-2 SMART
ZnF_C2H2 271 293 8.34e-3 SMART
ZnF_C2H2 299 321 2.12e-4 SMART
ZnF_C2H2 327 350 1.18e-2 SMART
ZnF_C2H2 356 378 1.03e-2 SMART
ZnF_C2H2 384 407 2.53e-2 SMART
low complexity region 419 427 N/A INTRINSIC
low complexity region 477 491 N/A INTRINSIC
low complexity region 492 505 N/A INTRINSIC
low complexity region 515 526 N/A INTRINSIC
low complexity region 544 554 N/A INTRINSIC
low complexity region 578 599 N/A INTRINSIC
low complexity region 681 715 N/A INTRINSIC
low complexity region 725 744 N/A INTRINSIC
low complexity region 771 793 N/A INTRINSIC
low complexity region 843 851 N/A INTRINSIC
low complexity region 880 895 N/A INTRINSIC
ZnF_C2H2 1036 1058 2.2e-2 SMART
coiled coil region 1060 1082 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113449
AA Change: I128M

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000109076
Gene: ENSMUSG00000029249
AA Change: I128M

DomainStartEndE-ValueType
low complexity region 85 95 N/A INTRINSIC
ZnF_C2H2 154 176 1.53e-1 SMART
ZnF_C2H2 211 233 4.23e0 SMART
ZnF_C2H2 243 265 2.53e-2 SMART
ZnF_C2H2 271 293 8.34e-3 SMART
ZnF_C2H2 299 321 2.12e-4 SMART
ZnF_C2H2 327 350 1.18e-2 SMART
ZnF_C2H2 356 378 1.03e-2 SMART
ZnF_C2H2 384 407 2.53e-2 SMART
low complexity region 419 427 N/A INTRINSIC
low complexity region 477 491 N/A INTRINSIC
low complexity region 492 505 N/A INTRINSIC
low complexity region 515 526 N/A INTRINSIC
low complexity region 544 554 N/A INTRINSIC
low complexity region 578 599 N/A INTRINSIC
low complexity region 681 715 N/A INTRINSIC
low complexity region 725 744 N/A INTRINSIC
low complexity region 771 793 N/A INTRINSIC
low complexity region 843 851 N/A INTRINSIC
low complexity region 880 895 N/A INTRINSIC
ZnF_C2H2 1036 1058 2.2e-2 SMART
coiled coil region 1060 1082 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcriptional repressor that represses neuronal genes in non-neuronal tissues. It is a member of the Kruppel-type zinc finger transcription factor family. It represses transcription by binding a DNA sequence element called the neuron-restrictive silencer element. The protein is also found in undifferentiated neuronal progenitor cells and it is thought that this repressor may act as a master negative regular of neurogenesis. Alternatively spliced transcript variants have been described [provided by RefSeq, Jul 2010]
PHENOTYPE: Targeted mutation of this gene results in embryonic lethality preceded by growth retardation and abnormal cellular organization in several tissues, including the hindbrain and somites. Mice with conditional deletions exhibit increased apoptosis in affected cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik TCC TCCGCC 6: 96,165,097 probably benign Het
1700123L14Rik TCC TCCCCC 6: 96,165,103 probably benign Het
2010111I01Rik G A 13: 63,068,251 V446I probably damaging Het
Abi1 T C 2: 22,953,543 T297A probably benign Het
Acadl G T 1: 66,853,178 T162K probably benign Het
Aldoart2 A T 12: 55,565,751 I154F probably damaging Het
Alkbh8 G A 9: 3,385,478 R625H probably damaging Het
Ankrd31 T A 13: 96,832,528 V891E probably benign Het
Atp8b5 C T 4: 43,356,982 R577* probably null Het
Capn3 G T 2: 120,486,386 E285D probably benign Het
Cd79b G T 11: 106,313,700 P87T probably damaging Het
Celsr2 T G 3: 108,412,655 D947A probably damaging Het
Csmd3 A C 15: 47,706,387 S1213R Het
Cyp2j5 T C 4: 96,664,004 M3V probably benign Het
Ddi1 C T 9: 6,265,787 R194K probably benign Het
Decr1 T C 4: 15,933,019 K49R probably benign Het
Dnah10 A C 5: 124,828,511 E4130A probably benign Het
Dst A G 1: 34,284,363 D4648G probably damaging Het
Ecd A G 14: 20,329,952 probably null Het
Erbin A T 13: 103,834,356 Y917* probably null Het
Evpl T C 11: 116,223,163 K1234E probably benign Het
F11r T A 1: 171,461,623 Y218N possibly damaging Het
Fam43a C G 16: 30,601,804 T402S probably benign Het
Frem2 T C 3: 53,549,643 N2096S probably benign Het
Gm7697 A T 8: 69,522,752 Y21N possibly damaging Het
Gpd2 T A 2: 57,306,950 Y172* probably null Het
Hscb A G 5: 110,835,978 V90A probably benign Het
Iqgap2 T C 13: 95,657,879 D1195G probably damaging Het
Map2k2 T C 10: 81,115,066 I115T probably damaging Het
Mast2 C T 4: 116,312,975 R707H probably damaging Het
Mindy4 A G 6: 55,300,992 N607S probably damaging Het
Mrpl9 T A 3: 94,443,743 Y77N probably damaging Het
Muc16 G A 9: 18,659,051 T724I unknown Het
Nat3 A T 8: 67,547,826 Y119F possibly damaging Het
Nol7 T C 13: 43,401,514 S208P probably damaging Het
Notch3 A T 17: 32,146,571 C1056S probably damaging Het
Olfr1039 A T 2: 86,131,377 Y95* probably null Het
Olfr146 G T 9: 39,019,487 T18K probably damaging Het
Olfr399 T A 11: 74,054,475 I95F probably benign Het
Olfr71 A T 4: 43,705,884 V228E probably damaging Het
Osbpl3 A C 6: 50,346,015 L288R probably damaging Het
Oscp1 A C 4: 126,088,323 D352A possibly damaging Het
Pcdh9 G A 14: 93,885,786 R983C probably benign Het
Pcdhgb8 T C 18: 37,763,502 S542P probably benign Het
Pi4ka T C 16: 17,356,166 T490A Het
Pkd1l1 A T 11: 8,947,315 D531E Het
Prr3 G T 17: 35,979,161 D26E possibly damaging Het
Psmd8 T C 7: 29,180,576 K24E probably benign Het
Rasgrp4 G A 7: 29,149,937 C583Y probably damaging Het
Rftn1 A T 17: 50,086,579 F144I probably damaging Het
Rusc2 T C 4: 43,421,851 F757S probably benign Het
Ryr1 A G 7: 29,083,385 S1942P probably benign Het
Sdk2 C T 11: 113,854,351 R706Q probably damaging Het
Sergef G T 7: 46,614,638 T275K probably damaging Het
Serpina10 T C 12: 103,628,310 T217A probably damaging Het
Shd G C 17: 55,976,235 S288T probably damaging Het
Siglec15 C A 18: 78,048,588 A133S possibly damaging Het
Stat4 C T 1: 52,079,773 P325L probably damaging Het
Syt8 G A 7: 142,440,144 G344D probably damaging Het
Tes A G 6: 17,097,292 E133G probably benign Het
Tmprss2 T C 16: 97,568,416 Y386C probably damaging Het
Tnfrsf11b A T 15: 54,252,106 L365Q probably damaging Het
Tns1 T A 1: 73,953,437 D67V probably damaging Het
Tns2 T C 15: 102,112,845 S982P probably damaging Het
Tpcn2 A T 7: 145,260,946 F473I probably benign Het
Tsg101 A T 7: 46,892,509 I232N probably damaging Het
Ttc3 T C 16: 94,467,989 S1977P probably benign Het
Ttll11 T A 2: 35,979,515 E37V unknown Het
Ttn A T 2: 76,818,816 V12716E possibly damaging Het
Vmn2r70 A C 7: 85,563,715 S495A probably benign Het
Zfp974 A G 7: 27,911,272 C343R probably damaging Het
Zfy1 A T Y: 726,004 I587N possibly damaging Het
Other mutations in Rest
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02339:Rest APN 5 77275288 missense probably damaging 1.00
pace UTSW 5 77275243 missense possibly damaging 0.94
ruhe UTSW 5 77268362 missense possibly damaging 0.71
R0027:Rest UTSW 5 77282551 missense probably benign
R0479:Rest UTSW 5 77282751 missense probably damaging 0.99
R0526:Rest UTSW 5 77281027 missense probably damaging 0.98
R1865:Rest UTSW 5 77280898 missense probably damaging 1.00
R1869:Rest UTSW 5 77268362 missense possibly damaging 0.71
R1870:Rest UTSW 5 77268362 missense possibly damaging 0.71
R2089:Rest UTSW 5 77281279 missense possibly damaging 0.92
R2091:Rest UTSW 5 77281279 missense possibly damaging 0.92
R2091:Rest UTSW 5 77281279 missense possibly damaging 0.92
R2347:Rest UTSW 5 77268593 missense probably damaging 1.00
R2366:Rest UTSW 5 77268187 missense probably benign 0.00
R3609:Rest UTSW 5 77282800 missense probably benign 0.06
R4249:Rest UTSW 5 77282112 missense probably benign
R4471:Rest UTSW 5 77281180 missense probably benign 0.01
R4472:Rest UTSW 5 77281180 missense probably benign 0.01
R4685:Rest UTSW 5 77275243 missense possibly damaging 0.94
R5175:Rest UTSW 5 77268372 missense probably damaging 1.00
R5566:Rest UTSW 5 77282326 missense probably benign 0.00
R5686:Rest UTSW 5 77281726 missense probably benign 0.01
R5976:Rest UTSW 5 77268272 missense probably benign 0.07
R6052:Rest UTSW 5 77281180 missense probably benign 0.34
R6076:Rest UTSW 5 77282974 missense unknown
R6249:Rest UTSW 5 77281224 missense probably benign 0.01
R6448:Rest UTSW 5 77281471 missense possibly damaging 0.75
R6681:Rest UTSW 5 77280997 missense probably damaging 1.00
R6974:Rest UTSW 5 77268199 missense probably damaging 1.00
R7185:Rest UTSW 5 77282484 missense probably benign
R7216:Rest UTSW 5 77282608 missense probably benign 0.04
R7355:Rest UTSW 5 77268028 missense probably benign 0.23
R7360:Rest UTSW 5 77281129 missense probably benign 0.36
R7705:Rest UTSW 5 77268272 missense probably damaging 1.00
R8220:Rest UTSW 5 77282478 missense probably benign
R8441:Rest UTSW 5 77281919 missense possibly damaging 0.95
R8699:Rest UTSW 5 77281542 missense probably benign 0.04
R8879:Rest UTSW 5 77282511 missense probably benign 0.00
R8940:Rest UTSW 5 77282868 missense possibly damaging 0.91
R8961:Rest UTSW 5 77268635 missense probably damaging 1.00
R9165:Rest UTSW 5 77281804 small deletion probably benign
R9167:Rest UTSW 5 77281804 small deletion probably benign
R9168:Rest UTSW 5 77281804 small deletion probably benign
R9170:Rest UTSW 5 77281804 small deletion probably benign
R9377:Rest UTSW 5 77268281 missense possibly damaging 0.47
R9476:Rest UTSW 5 77268251 missense probably damaging 0.99
R9566:Rest UTSW 5 77268430 nonsense probably null
R9596:Rest UTSW 5 77275294 missense probably damaging 1.00
Z1177:Rest UTSW 5 77280909 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- GCAGATGGCCGAATTGATG -3'
(R):5'- TTGGAGAACTCGCCCTCTTC -3'

Sequencing Primer
(F):5'- TTGATGCCCGTGGGAGACAAC -3'
(R):5'- CCGACTCCCAGGCTTTG -3'
Posted On 2020-01-23