Incidental Mutation 'R8052:Vmn2r70'
ID619114
Institutional Source Beutler Lab
Gene Symbol Vmn2r70
Ensembl Gene ENSMUSG00000090806
Gene Namevomeronasal 2, receptor 70
SynonymsEG620835
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R8052 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location85558703-85569088 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 85563715 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 495 (S495A)
Ref Sequence ENSEMBL: ENSMUSP00000129703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168230]
Predicted Effect probably benign
Transcript: ENSMUST00000168230
AA Change: S495A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129703
Gene: ENSMUSG00000090806
AA Change: S495A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:ANF_receptor 77 468 2.5e-28 PFAM
Pfam:NCD3G 510 562 1.5e-19 PFAM
Pfam:7tm_3 592 830 1.2e-52 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik TCC TCCGCC 6: 96,165,097 probably benign Het
1700123L14Rik TCC TCCCCC 6: 96,165,103 probably benign Het
2010111I01Rik G A 13: 63,068,251 V446I probably damaging Het
Abi1 T C 2: 22,953,543 T297A probably benign Het
Acadl G T 1: 66,853,178 T162K probably benign Het
Aldoart2 A T 12: 55,565,751 I154F probably damaging Het
Alkbh8 G A 9: 3,385,478 R625H probably damaging Het
Ankrd31 T A 13: 96,832,528 V891E probably benign Het
Atp8b5 C T 4: 43,356,982 R577* probably null Het
Capn3 G T 2: 120,486,386 E285D probably benign Het
Cd79b G T 11: 106,313,700 P87T probably damaging Het
Celsr2 T G 3: 108,412,655 D947A probably damaging Het
Csmd3 A C 15: 47,706,387 S1213R Het
Cyp2j5 T C 4: 96,664,004 M3V probably benign Het
Ddi1 C T 9: 6,265,787 R194K probably benign Het
Decr1 T C 4: 15,933,019 K49R probably benign Het
Dnah10 A C 5: 124,828,511 E4130A probably benign Het
Dst A G 1: 34,284,363 D4648G probably damaging Het
Ecd A G 14: 20,329,952 probably null Het
Erbin A T 13: 103,834,356 Y917* probably null Het
Evpl T C 11: 116,223,163 K1234E probably benign Het
F11r T A 1: 171,461,623 Y218N possibly damaging Het
Fam43a C G 16: 30,601,804 T402S probably benign Het
Frem2 T C 3: 53,549,643 N2096S probably benign Het
Gm7697 A T 8: 69,522,752 Y21N possibly damaging Het
Gpd2 T A 2: 57,306,950 Y172* probably null Het
Hscb A G 5: 110,835,978 V90A probably benign Het
Iqgap2 T C 13: 95,657,879 D1195G probably damaging Het
Map2k2 T C 10: 81,115,066 I115T probably damaging Het
Mast2 C T 4: 116,312,975 R707H probably damaging Het
Mindy4 A G 6: 55,300,992 N607S probably damaging Het
Mrpl9 T A 3: 94,443,743 Y77N probably damaging Het
Muc16 G A 9: 18,659,051 T724I unknown Het
Nat3 A T 8: 67,547,826 Y119F possibly damaging Het
Nol7 T C 13: 43,401,514 S208P probably damaging Het
Notch3 A T 17: 32,146,571 C1056S probably damaging Het
Olfr1039 A T 2: 86,131,377 Y95* probably null Het
Olfr146 G T 9: 39,019,487 T18K probably damaging Het
Olfr399 T A 11: 74,054,475 I95F probably benign Het
Olfr71 A T 4: 43,705,884 V228E probably damaging Het
Osbpl3 A C 6: 50,346,015 L288R probably damaging Het
Oscp1 A C 4: 126,088,323 D352A possibly damaging Het
Pcdh9 G A 14: 93,885,786 R983C probably benign Het
Pcdhgb8 T C 18: 37,763,502 S542P probably benign Het
Pi4ka T C 16: 17,356,166 T490A Het
Pkd1l1 A T 11: 8,947,315 D531E Het
Prr3 G T 17: 35,979,161 D26E possibly damaging Het
Psmd8 T C 7: 29,180,576 K24E probably benign Het
Rasgrp4 G A 7: 29,149,937 C583Y probably damaging Het
Rest A G 5: 77,268,324 I128M probably benign Het
Rftn1 A T 17: 50,086,579 F144I probably damaging Het
Rusc2 T C 4: 43,421,851 F757S probably benign Het
Ryr1 A G 7: 29,083,385 S1942P probably benign Het
Sdk2 C T 11: 113,854,351 R706Q probably damaging Het
Sergef G T 7: 46,614,638 T275K probably damaging Het
Serpina10 T C 12: 103,628,310 T217A probably damaging Het
Shd G C 17: 55,976,235 S288T probably damaging Het
Siglec15 C A 18: 78,048,588 A133S possibly damaging Het
Stat4 C T 1: 52,079,773 P325L probably damaging Het
Syt8 G A 7: 142,440,144 G344D probably damaging Het
Tes A G 6: 17,097,292 E133G probably benign Het
Tmprss2 T C 16: 97,568,416 Y386C probably damaging Het
Tnfrsf11b A T 15: 54,252,106 L365Q probably damaging Het
Tns1 T A 1: 73,953,437 D67V probably damaging Het
Tns2 T C 15: 102,112,845 S982P probably damaging Het
Tpcn2 A T 7: 145,260,946 F473I probably benign Het
Tsg101 A T 7: 46,892,509 I232N probably damaging Het
Ttc3 T C 16: 94,467,989 S1977P probably benign Het
Ttll11 T A 2: 35,979,515 E37V unknown Het
Ttn A T 2: 76,818,816 V12716E possibly damaging Het
Zfp974 A G 7: 27,911,272 C343R probably damaging Het
Zfy1 A T Y: 726,004 I587N possibly damaging Het
Other mutations in Vmn2r70
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00978:Vmn2r70 APN 7 85563799 missense probably benign 0.00
IGL01140:Vmn2r70 APN 7 85565171 nonsense probably null
IGL01287:Vmn2r70 APN 7 85569019 nonsense probably null
IGL01581:Vmn2r70 APN 7 85563914 splice site probably null
IGL01632:Vmn2r70 APN 7 85566072 missense probably benign 0.00
IGL01725:Vmn2r70 APN 7 85559386 missense probably damaging 1.00
IGL02244:Vmn2r70 APN 7 85565003 missense probably benign
IGL02288:Vmn2r70 APN 7 85565134 missense probably benign 0.31
IGL02313:Vmn2r70 APN 7 85565168 missense probably damaging 0.99
IGL02591:Vmn2r70 APN 7 85564945 missense probably damaging 0.96
IGL02725:Vmn2r70 APN 7 85565345 missense possibly damaging 0.46
IGL02797:Vmn2r70 APN 7 85559087 missense probably benign 0.00
R0045:Vmn2r70 UTSW 7 85566044 missense probably damaging 1.00
R0729:Vmn2r70 UTSW 7 85565904 missense probably benign 0.00
R0967:Vmn2r70 UTSW 7 85559619 missense probably damaging 0.99
R1217:Vmn2r70 UTSW 7 85559061 missense probably damaging 1.00
R1351:Vmn2r70 UTSW 7 85565054 missense probably damaging 1.00
R1387:Vmn2r70 UTSW 7 85558761 missense probably benign 0.12
R1483:Vmn2r70 UTSW 7 85559167 missense probably benign 0.04
R1796:Vmn2r70 UTSW 7 85563803 nonsense probably null
R1809:Vmn2r70 UTSW 7 85565922 missense probably benign 0.23
R2154:Vmn2r70 UTSW 7 85563715 missense possibly damaging 0.67
R2173:Vmn2r70 UTSW 7 85565082 missense probably benign
R2334:Vmn2r70 UTSW 7 85559592 missense probably benign 0.05
R2871:Vmn2r70 UTSW 7 85559019 missense probably damaging 1.00
R2871:Vmn2r70 UTSW 7 85559019 missense probably damaging 1.00
R3975:Vmn2r70 UTSW 7 85559332 missense probably benign 0.00
R4525:Vmn2r70 UTSW 7 85559579 missense probably damaging 1.00
R4527:Vmn2r70 UTSW 7 85559579 missense probably damaging 1.00
R4535:Vmn2r70 UTSW 7 85565333 missense probably damaging 1.00
R5181:Vmn2r70 UTSW 7 85559179 missense probably damaging 0.99
R5600:Vmn2r70 UTSW 7 85563727 missense probably benign 0.07
R5641:Vmn2r70 UTSW 7 85559364 missense probably damaging 0.99
R5726:Vmn2r70 UTSW 7 85559107 missense probably damaging 1.00
R5943:Vmn2r70 UTSW 7 85565991 missense probably benign 0.09
R6166:Vmn2r70 UTSW 7 85565981 missense probably benign 0.25
R6272:Vmn2r70 UTSW 7 85558986 missense probably damaging 1.00
R6324:Vmn2r70 UTSW 7 85558879 missense probably benign 0.01
R6429:Vmn2r70 UTSW 7 85559068 missense probably damaging 1.00
R6449:Vmn2r70 UTSW 7 85564949 missense probably damaging 1.00
R6512:Vmn2r70 UTSW 7 85566097 missense probably benign
R7000:Vmn2r70 UTSW 7 85559611 missense probably damaging 0.99
R7141:Vmn2r70 UTSW 7 85558836 missense probably benign
R7153:Vmn2r70 UTSW 7 85565054 missense probably damaging 1.00
R7424:Vmn2r70 UTSW 7 85563868 missense probably damaging 1.00
R7565:Vmn2r70 UTSW 7 85565291 missense probably benign 0.35
R7567:Vmn2r70 UTSW 7 85565035 missense probably benign 0.41
R7593:Vmn2r70 UTSW 7 85566104 nonsense probably null
R7660:Vmn2r70 UTSW 7 85568922 missense probably damaging 0.99
R7806:Vmn2r70 UTSW 7 85559193 missense probably benign
R7892:Vmn2r70 UTSW 7 85559380 missense possibly damaging 0.58
R7965:Vmn2r70 UTSW 7 85561863 missense probably damaging 0.96
R8251:Vmn2r70 UTSW 7 85565978 nonsense probably null
Z1088:Vmn2r70 UTSW 7 85564760 missense possibly damaging 0.53
Z1176:Vmn2r70 UTSW 7 85569045 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTCGGGCAGTGTAAAGTAATTC -3'
(R):5'- TTGAATACTTCTGGCAAGGTTAGG -3'

Sequencing Primer
(F):5'- GGCAGTGTAAAGTAATTCAATAAAGG -3'
(R):5'- AGATGTTCTCTGTTCTGAAGACC -3'
Posted On2020-01-23