Incidental Mutation 'R8052:Syt8'
ID619115
Institutional Source Beutler Lab
Gene Symbol Syt8
Ensembl Gene ENSMUSG00000031098
Gene Namesynaptotagmin VIII
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R8052 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location142434850-142440396 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 142440144 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 344 (G344D)
Ref Sequence ENSEMBL: ENSMUSP00000113545 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097939] [ENSMUST00000105971] [ENSMUST00000105973] [ENSMUST00000105976] [ENSMUST00000105977] [ENSMUST00000118276] [ENSMUST00000122393] [ENSMUST00000145287] [ENSMUST00000149529] [ENSMUST00000210239] [ENSMUST00000210746]
Predicted Effect probably damaging
Transcript: ENSMUST00000097939
AA Change: G338D

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000095552
Gene: ENSMUSG00000031098
AA Change: G338D

DomainStartEndE-ValueType
transmembrane domain 37 59 N/A INTRINSIC
C2 123 222 1.86e-15 SMART
C2 251 361 8.69e-16 SMART
low complexity region 380 388 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105971
SMART Domains Protein: ENSMUSP00000101591
Gene: ENSMUSG00000031097

DomainStartEndE-ValueType
Pfam:Troponin 15 145 1.1e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105973
SMART Domains Protein: ENSMUSP00000101593
Gene: ENSMUSG00000031097

DomainStartEndE-ValueType
Pfam:Troponin 10 153 1.9e-49 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105976
AA Change: G338D

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101596
Gene: ENSMUSG00000031098
AA Change: G338D

DomainStartEndE-ValueType
transmembrane domain 37 59 N/A INTRINSIC
C2 123 222 1.86e-15 SMART
C2 251 361 8.69e-16 SMART
low complexity region 380 388 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105977
SMART Domains Protein: ENSMUSP00000101597
Gene: ENSMUSG00000031098

DomainStartEndE-ValueType
Pfam:UPF0560 14 88 2.7e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000118276
AA Change: G344D

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113545
Gene: ENSMUSG00000031098
AA Change: G344D

DomainStartEndE-ValueType
transmembrane domain 43 65 N/A INTRINSIC
C2 129 228 1.86e-15 SMART
C2 257 367 8.69e-16 SMART
low complexity region 386 394 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000122393
AA Change: G344D

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112689
Gene: ENSMUSG00000031098
AA Change: G344D

DomainStartEndE-ValueType
transmembrane domain 43 65 N/A INTRINSIC
C2 129 228 1.86e-15 SMART
C2 257 367 8.69e-16 SMART
low complexity region 386 394 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145287
SMART Domains Protein: ENSMUSP00000121819
Gene: ENSMUSG00000031097

DomainStartEndE-ValueType
Pfam:Troponin 15 135 4.2e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149529
SMART Domains Protein: ENSMUSP00000122733
Gene: ENSMUSG00000031097

DomainStartEndE-ValueType
Pfam:Troponin 15 145 1.1e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000210239
Predicted Effect probably benign
Transcript: ENSMUST00000210746
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the synaptotagmin protein family. Synaptotagmins are membrane proteins that are important in neurotransmission and hormone secretion, both of which involve regulated exocytosis. Expression of the encoded protein in human pancreatic islets has been connected to activity of the promoter for the insulin gene, on the same chromosome several hundred kilobases away (PMID: 21336277 and 22928559). This association would link response to gluclose to insulin secretion. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik TCC TCCGCC 6: 96,165,097 probably benign Het
1700123L14Rik TCC TCCCCC 6: 96,165,103 probably benign Het
2010111I01Rik G A 13: 63,068,251 V446I probably damaging Het
Abi1 T C 2: 22,953,543 T297A probably benign Het
Acadl G T 1: 66,853,178 T162K probably benign Het
Aldoart2 A T 12: 55,565,751 I154F probably damaging Het
Alkbh8 G A 9: 3,385,478 R625H probably damaging Het
Ankrd31 T A 13: 96,832,528 V891E probably benign Het
Atp8b5 C T 4: 43,356,982 R577* probably null Het
Capn3 G T 2: 120,486,386 E285D probably benign Het
Cd79b G T 11: 106,313,700 P87T probably damaging Het
Celsr2 T G 3: 108,412,655 D947A probably damaging Het
Csmd3 A C 15: 47,706,387 S1213R Het
Cyp2j5 T C 4: 96,664,004 M3V probably benign Het
Ddi1 C T 9: 6,265,787 R194K probably benign Het
Decr1 T C 4: 15,933,019 K49R probably benign Het
Dnah10 A C 5: 124,828,511 E4130A probably benign Het
Dst A G 1: 34,284,363 D4648G probably damaging Het
Ecd A G 14: 20,329,952 probably null Het
Erbin A T 13: 103,834,356 Y917* probably null Het
Evpl T C 11: 116,223,163 K1234E probably benign Het
F11r T A 1: 171,461,623 Y218N possibly damaging Het
Fam43a C G 16: 30,601,804 T402S probably benign Het
Frem2 T C 3: 53,549,643 N2096S probably benign Het
Gm7697 A T 8: 69,522,752 Y21N possibly damaging Het
Gpd2 T A 2: 57,306,950 Y172* probably null Het
Hscb A G 5: 110,835,978 V90A probably benign Het
Iqgap2 T C 13: 95,657,879 D1195G probably damaging Het
Map2k2 T C 10: 81,115,066 I115T probably damaging Het
Mast2 C T 4: 116,312,975 R707H probably damaging Het
Mindy4 A G 6: 55,300,992 N607S probably damaging Het
Mrpl9 T A 3: 94,443,743 Y77N probably damaging Het
Muc16 G A 9: 18,659,051 T724I unknown Het
Nat3 A T 8: 67,547,826 Y119F possibly damaging Het
Nol7 T C 13: 43,401,514 S208P probably damaging Het
Notch3 A T 17: 32,146,571 C1056S probably damaging Het
Olfr1039 A T 2: 86,131,377 Y95* probably null Het
Olfr146 G T 9: 39,019,487 T18K probably damaging Het
Olfr399 T A 11: 74,054,475 I95F probably benign Het
Olfr71 A T 4: 43,705,884 V228E probably damaging Het
Osbpl3 A C 6: 50,346,015 L288R probably damaging Het
Oscp1 A C 4: 126,088,323 D352A possibly damaging Het
Pcdh9 G A 14: 93,885,786 R983C probably benign Het
Pcdhgb8 T C 18: 37,763,502 S542P probably benign Het
Pi4ka T C 16: 17,356,166 T490A Het
Pkd1l1 A T 11: 8,947,315 D531E Het
Prr3 G T 17: 35,979,161 D26E possibly damaging Het
Psmd8 T C 7: 29,180,576 K24E probably benign Het
Rasgrp4 G A 7: 29,149,937 C583Y probably damaging Het
Rest A G 5: 77,268,324 I128M probably benign Het
Rftn1 A T 17: 50,086,579 F144I probably damaging Het
Rusc2 T C 4: 43,421,851 F757S probably benign Het
Ryr1 A G 7: 29,083,385 S1942P probably benign Het
Sdk2 C T 11: 113,854,351 R706Q probably damaging Het
Sergef G T 7: 46,614,638 T275K probably damaging Het
Serpina10 T C 12: 103,628,310 T217A probably damaging Het
Shd G C 17: 55,976,235 S288T probably damaging Het
Siglec15 C A 18: 78,048,588 A133S possibly damaging Het
Stat4 C T 1: 52,079,773 P325L probably damaging Het
Tes A G 6: 17,097,292 E133G probably benign Het
Tmprss2 T C 16: 97,568,416 Y386C probably damaging Het
Tnfrsf11b A T 15: 54,252,106 L365Q probably damaging Het
Tns1 T A 1: 73,953,437 D67V probably damaging Het
Tns2 T C 15: 102,112,845 S982P probably damaging Het
Tpcn2 A T 7: 145,260,946 F473I probably benign Het
Tsg101 A T 7: 46,892,509 I232N probably damaging Het
Ttc3 T C 16: 94,467,989 S1977P probably benign Het
Ttll11 T A 2: 35,979,515 E37V unknown Het
Ttn A T 2: 76,818,816 V12716E possibly damaging Het
Vmn2r70 A C 7: 85,563,715 S495A probably benign Het
Zfp974 A G 7: 27,911,272 C343R probably damaging Het
Zfy1 A T Y: 726,004 I587N possibly damaging Het
Other mutations in Syt8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01980:Syt8 APN 7 142440140 missense probably damaging 1.00
R0032:Syt8 UTSW 7 142439189 missense probably benign 0.00
R0032:Syt8 UTSW 7 142439189 missense probably benign 0.00
R1819:Syt8 UTSW 7 142438234 missense possibly damaging 0.81
R4549:Syt8 UTSW 7 142439462 missense probably benign 0.13
R4550:Syt8 UTSW 7 142439462 missense probably benign 0.13
R6964:Syt8 UTSW 7 142439421 missense probably benign 0.00
R8008:Syt8 UTSW 7 142438522 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCTACTTCAACGAGGCCTTC -3'
(R):5'- TATCCACAGCTCTCCATCTGGG -3'

Sequencing Primer
(F):5'- TGGTTCCCGTTAGCCAGC -3'
(R):5'- TCTGGGAAAACTGAGACCCGC -3'
Posted On2020-01-23