Incidental Mutation 'R0662:Pank3'
ID61912
Institutional Source Beutler Lab
Gene Symbol Pank3
Ensembl Gene ENSMUSG00000018846
Gene Namepantothenate kinase 3
Synonyms
MMRRC Submission 038847-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.259) question?
Stock #R0662 (G1)
Quality Score197
Status Not validated
Chromosome11
Chromosomal Location35769484-35791285 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35778650 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 237 (M237T)
Ref Sequence ENSEMBL: ENSMUSP00000018990 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018990]
Predicted Effect probably damaging
Transcript: ENSMUST00000018990
AA Change: M237T

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000018990
Gene: ENSMUSG00000018846
AA Change: M237T

DomainStartEndE-ValueType
Pfam:Fumble 13 365 1e-118 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083619
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.6%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the pantothenate kinase family. Pantothenate kinase is a key regulatory enzyme in the biosynthesis of coenzyme A (CoA) in bacteria and mammalian cells. It catalyzes the first committed step in the universal biosynthetic pathway leading to CoA and is itself subject to regulation through feedback inhibition by CoA. This family member is expressed most abundantly in the liver. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele in combination with either a knock-out of Pank1 or Pank2 exhibit complete embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf T C 19: 31,920,938 S241P probably benign Het
Ankrd53 G T 6: 83,763,643 V83L probably damaging Het
Armcx2 G A X: 134,805,636 T416I possibly damaging Het
C4b G A 17: 34,730,888 R1441C probably damaging Het
Cacng3 T C 7: 122,768,359 I154T probably damaging Het
Cand2 A G 6: 115,787,210 D315G probably benign Het
Celsr2 A T 3: 108,398,520 S2089R probably damaging Het
Chd9 A C 8: 90,977,676 K247Q probably damaging Het
Chil1 A C 1: 134,188,573 S263R probably damaging Het
Clec12b A C 6: 129,376,237 C262W probably damaging Het
Cpsf7 T C 19: 10,526,008 M1T probably null Het
Cul3 T C 1: 80,271,565 D597G probably damaging Het
Dcaf11 T C 14: 55,565,507 V251A possibly damaging Het
Eno2 A T 6: 124,763,811 F218I probably damaging Het
Frmd6 A T 12: 70,899,444 R549* probably null Het
Fyb2 G A 4: 104,995,698 S461N possibly damaging Het
Gm5709 A T 3: 59,606,743 noncoding transcript Het
Hormad1 T C 3: 95,575,599 I132T probably benign Het
Itga7 G T 10: 128,953,531 R981L probably damaging Het
Itgbl1 T A 14: 123,827,894 N153K probably damaging Het
Itih1 T C 14: 30,933,360 E626G possibly damaging Het
Kat6b AGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGA 14: 21,662,349 probably benign Het
Kcna2 A T 3: 107,105,401 T433S probably benign Het
Map4k5 A G 12: 69,813,153 V673A probably damaging Het
Mmp27 T A 9: 7,577,650 V281E probably benign Het
Nr2c1 A T 10: 94,190,738 I492F probably damaging Het
Olfr131 A G 17: 38,082,933 I15T probably benign Het
Olfr292 A G 7: 86,694,630 Y58C possibly damaging Het
Olfr457 C T 6: 42,471,774 V135M possibly damaging Het
Olfr703 A T 7: 106,844,649 I13F probably benign Het
Olfr77 G C 9: 19,920,500 C97S probably damaging Het
Olfr862 T C 9: 19,883,952 M118V probably benign Het
Olfr911-ps1 T A 9: 38,524,026 M98K probably damaging Het
Plekhh1 A G 12: 79,078,993 T1268A probably benign Het
Ptchd4 A G 17: 42,502,576 Y456C probably damaging Het
Rhcg C T 7: 79,599,729 V310M probably damaging Het
Ryr1 A T 7: 29,100,189 D906E probably damaging Het
Sez6l A T 5: 112,473,422 L262Q probably damaging Het
Shprh G A 10: 11,186,847 V1233I probably damaging Het
Slc3a1 A G 17: 85,037,207 E267G possibly damaging Het
Slc5a5 T A 8: 70,883,875 T616S probably benign Het
St5 G T 7: 109,557,426 P39Q probably damaging Het
Syne3 T G 12: 104,961,510 E318A probably benign Het
Tecpr2 A G 12: 110,896,228 T25A probably benign Het
Ubxn1 T A 19: 8,875,197 probably null Het
Unc5b C A 10: 60,772,583 R616L possibly damaging Het
Ush2a A G 1: 188,351,093 T278A probably benign Het
Utp14b A G 1: 78,664,999 T205A probably damaging Het
Vmn1r219 T C 13: 23,163,453 S271P possibly damaging Het
Vmn2r76 C T 7: 86,230,370 V241M probably benign Het
Zbtb24 G A 10: 41,462,279 G429D probably damaging Het
Zdhhc2 T C 8: 40,447,098 S68P probably damaging Het
Zfp719 G A 7: 43,584,254 M32I possibly damaging Het
Zfp975 T C 7: 42,662,526 N221S probably benign Het
Other mutations in Pank3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03109:Pank3 APN 11 35777674 missense probably benign 0.04
R0217:Pank3 UTSW 11 35777728 missense probably benign
R0243:Pank3 UTSW 11 35781716 splice site probably benign
R0454:Pank3 UTSW 11 35777709 missense probably benign
R1522:Pank3 UTSW 11 35781681 missense probably benign 0.45
R2246:Pank3 UTSW 11 35783506 missense probably benign 0.00
R6396:Pank3 UTSW 11 35778689 missense probably damaging 1.00
R6905:Pank3 UTSW 11 35776412 missense probably benign 0.01
R8143:Pank3 UTSW 11 35776209 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGCACACGGTCTCATCGGTCTAC -3'
(R):5'- CCTTGCTCCTCCACTGAGAAATATCAC -3'

Sequencing Primer
(F):5'- TCTTTCAGTGCATACACAGGAG -3'
(R):5'- ttctgtttgctgattgtgcc -3'
Posted On2013-07-30