Incidental Mutation 'R8052:Pkd1l1'
ID619124
Institutional Source Beutler Lab
Gene Symbol Pkd1l1
Ensembl Gene ENSMUSG00000046634
Gene Namepolycystic kidney disease 1 like 1
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8052 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location8826708-8973266 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 8947315 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 531 (D531E)
Gene Model predicted gene model for transcript(s): [ENSMUST00000178195]
Predicted Effect
SMART Domains Protein: ENSMUSP00000120803
Gene: ENSMUSG00000046634
AA Change: D531E

DomainStartEndE-ValueType
low complexity region 172 184 N/A INTRINSIC
PKD 205 287 2.9e0 SMART
PKD 291 369 1.42e-9 SMART
Pfam:REJ 398 1001 1.7e-45 PFAM
low complexity region 1208 1218 N/A INTRINSIC
GPS 1370 1413 1.21e-1 SMART
transmembrane domain 1434 1451 N/A INTRINSIC
LH2 1479 1598 2.94e-3 SMART
transmembrane domain 1640 1659 N/A INTRINSIC
transmembrane domain 1679 1701 N/A INTRINSIC
transmembrane domain 1817 1839 N/A INTRINSIC
transmembrane domain 1854 1876 N/A INTRINSIC
Pfam:PKD_channel 2109 2339 1.5e-23 PFAM
transmembrane domain 2381 2403 N/A INTRINSIC
low complexity region 2436 2449 N/A INTRINSIC
low complexity region 2458 2469 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000178195
AA Change: D81E

PolyPhen 2 Score 0.522 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000136518
Gene: ENSMUSG00000046634
AA Change: D81E

DomainStartEndE-ValueType
Pfam:REJ 3 552 3.3e-41 PFAM
low complexity region 757 767 N/A INTRINSIC
Blast:GPS 919 965 2e-13 BLAST
transmembrane domain 983 1000 N/A INTRINSIC
Pfam:PLAT 1030 1145 7.2e-14 PFAM
transmembrane domain 1189 1208 N/A INTRINSIC
transmembrane domain 1228 1250 N/A INTRINSIC
transmembrane domain 1366 1388 N/A INTRINSIC
transmembrane domain 1403 1425 N/A INTRINSIC
Pfam:PKD_channel 1658 1889 2e-25 PFAM
transmembrane domain 1930 1952 N/A INTRINSIC
low complexity region 1985 1998 N/A INTRINSIC
low complexity region 2007 2018 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the polycystin protein family containing 11 transmembrane domains, a receptor for egg jelly (REJ) domain, and a polycystin-1, lipoxygenase, alpha-toxin (PLAT) domain. The encoded protein may play a role in the male reproductive system. Alternative splice variants have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU induced point mutation display lethality throughout fetal growth and development with abnormalities in left right patterning and heterotaxia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik TCC TCCGCC 6: 96,165,097 probably benign Het
1700123L14Rik TCC TCCCCC 6: 96,165,103 probably benign Het
2010111I01Rik G A 13: 63,068,251 V446I probably damaging Het
Abi1 T C 2: 22,953,543 T297A probably benign Het
Acadl G T 1: 66,853,178 T162K probably benign Het
Aldoart2 A T 12: 55,565,751 I154F probably damaging Het
Alkbh8 G A 9: 3,385,478 R625H probably damaging Het
Ankrd31 T A 13: 96,832,528 V891E probably benign Het
Atp8b5 C T 4: 43,356,982 R577* probably null Het
Capn3 G T 2: 120,486,386 E285D probably benign Het
Cd79b G T 11: 106,313,700 P87T probably damaging Het
Celsr2 T G 3: 108,412,655 D947A probably damaging Het
Csmd3 A C 15: 47,706,387 S1213R Het
Cyp2j5 T C 4: 96,664,004 M3V probably benign Het
Ddi1 C T 9: 6,265,787 R194K probably benign Het
Decr1 T C 4: 15,933,019 K49R probably benign Het
Dnah10 A C 5: 124,828,511 E4130A probably benign Het
Dst A G 1: 34,284,363 D4648G probably damaging Het
Ecd A G 14: 20,329,952 probably null Het
Erbin A T 13: 103,834,356 Y917* probably null Het
Evpl T C 11: 116,223,163 K1234E probably benign Het
F11r T A 1: 171,461,623 Y218N possibly damaging Het
Fam43a C G 16: 30,601,804 T402S probably benign Het
Frem2 T C 3: 53,549,643 N2096S probably benign Het
Gm7697 A T 8: 69,522,752 Y21N possibly damaging Het
Gpd2 T A 2: 57,306,950 Y172* probably null Het
Hscb A G 5: 110,835,978 V90A probably benign Het
Iqgap2 T C 13: 95,657,879 D1195G probably damaging Het
Map2k2 T C 10: 81,115,066 I115T probably damaging Het
Mast2 C T 4: 116,312,975 R707H probably damaging Het
Mindy4 A G 6: 55,300,992 N607S probably damaging Het
Mrpl9 T A 3: 94,443,743 Y77N probably damaging Het
Muc16 G A 9: 18,659,051 T724I unknown Het
Nat3 A T 8: 67,547,826 Y119F possibly damaging Het
Nol7 T C 13: 43,401,514 S208P probably damaging Het
Notch3 A T 17: 32,146,571 C1056S probably damaging Het
Olfr1039 A T 2: 86,131,377 Y95* probably null Het
Olfr146 G T 9: 39,019,487 T18K probably damaging Het
Olfr399 T A 11: 74,054,475 I95F probably benign Het
Olfr71 A T 4: 43,705,884 V228E probably damaging Het
Osbpl3 A C 6: 50,346,015 L288R probably damaging Het
Oscp1 A C 4: 126,088,323 D352A possibly damaging Het
Pcdh9 G A 14: 93,885,786 R983C probably benign Het
Pcdhgb8 T C 18: 37,763,502 S542P probably benign Het
Pi4ka T C 16: 17,356,166 T490A Het
Prr3 G T 17: 35,979,161 D26E possibly damaging Het
Psmd8 T C 7: 29,180,576 K24E probably benign Het
Rasgrp4 G A 7: 29,149,937 C583Y probably damaging Het
Rest A G 5: 77,268,324 I128M probably benign Het
Rftn1 A T 17: 50,086,579 F144I probably damaging Het
Rusc2 T C 4: 43,421,851 F757S probably benign Het
Ryr1 A G 7: 29,083,385 S1942P probably benign Het
Sdk2 C T 11: 113,854,351 R706Q probably damaging Het
Sergef G T 7: 46,614,638 T275K probably damaging Het
Serpina10 T C 12: 103,628,310 T217A probably damaging Het
Shd G C 17: 55,976,235 S288T probably damaging Het
Siglec15 C A 18: 78,048,588 A133S possibly damaging Het
Stat4 C T 1: 52,079,773 P325L probably damaging Het
Syt8 G A 7: 142,440,144 G344D probably damaging Het
Tes A G 6: 17,097,292 E133G probably benign Het
Tmprss2 T C 16: 97,568,416 Y386C probably damaging Het
Tnfrsf11b A T 15: 54,252,106 L365Q probably damaging Het
Tns1 T A 1: 73,953,437 D67V probably damaging Het
Tns2 T C 15: 102,112,845 S982P probably damaging Het
Tpcn2 A T 7: 145,260,946 F473I probably benign Het
Tsg101 A T 7: 46,892,509 I232N probably damaging Het
Ttc3 T C 16: 94,467,989 S1977P probably benign Het
Ttll11 T A 2: 35,979,515 E37V unknown Het
Ttn A T 2: 76,818,816 V12716E possibly damaging Het
Vmn2r70 A C 7: 85,563,715 S495A probably benign Het
Zfp974 A G 7: 27,911,272 C343R probably damaging Het
Zfy1 A T Y: 726,004 I587N possibly damaging Het
Other mutations in Pkd1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Pkd1l1 APN 11 8961971 missense unknown
IGL00156:Pkd1l1 APN 11 8950515 missense probably damaging 1.00
IGL00161:Pkd1l1 APN 11 8929353 critical splice donor site probably null
IGL00489:Pkd1l1 APN 11 8834773 critical splice donor site probably null
IGL00495:Pkd1l1 APN 11 8868493 missense probably benign 0.34
IGL00983:Pkd1l1 APN 11 8844585 missense probably benign
IGL01071:Pkd1l1 APN 11 8848921 missense probably benign 0.00
IGL01093:Pkd1l1 APN 11 8901345 missense probably benign 0.06
IGL01295:Pkd1l1 APN 11 8933685 missense possibly damaging 0.93
IGL01311:Pkd1l1 APN 11 8901174 missense possibly damaging 0.53
IGL01412:Pkd1l1 APN 11 8950409 missense possibly damaging 0.73
IGL01978:Pkd1l1 APN 11 8961336 missense unknown
IGL01999:Pkd1l1 APN 11 8836291 missense probably benign
IGL02080:Pkd1l1 APN 11 8961345 missense unknown
IGL02106:Pkd1l1 APN 11 8833800 missense probably damaging 1.00
IGL02216:Pkd1l1 APN 11 8834897 missense probably damaging 0.96
IGL02305:Pkd1l1 APN 11 8902467 missense probably benign
IGL02337:Pkd1l1 APN 11 8942079 missense probably damaging 1.00
IGL02576:Pkd1l1 APN 11 8844560 missense possibly damaging 0.61
IGL02704:Pkd1l1 APN 11 8834910 missense probably benign 0.00
IGL02814:Pkd1l1 APN 11 8902582 missense probably benign 0.01
IGL02904:Pkd1l1 APN 11 8868450 splice site probably benign
IGL02972:Pkd1l1 APN 11 8863908 missense probably damaging 0.99
IGL03091:Pkd1l1 APN 11 8855564 missense probably damaging 1.00
IGL03113:Pkd1l1 APN 11 8834793 missense probably benign 0.20
IGL03210:Pkd1l1 APN 11 8965127 missense unknown
PIT4581001:Pkd1l1 UTSW 11 8916298 frame shift probably null
R0020:Pkd1l1 UTSW 11 8875765 splice site probably benign
R0020:Pkd1l1 UTSW 11 8875765 splice site probably benign
R0496:Pkd1l1 UTSW 11 8929430 missense probably damaging 0.96
R0547:Pkd1l1 UTSW 11 8836448 splice site probably benign
R0582:Pkd1l1 UTSW 11 8931699 splice site probably benign
R0761:Pkd1l1 UTSW 11 8854375 missense probably damaging 1.00
R0969:Pkd1l1 UTSW 11 8936898 missense probably damaging 1.00
R1348:Pkd1l1 UTSW 11 8834806 missense probably benign 0.18
R1366:Pkd1l1 UTSW 11 8941038 splice site probably benign
R1401:Pkd1l1 UTSW 11 8854487 nonsense probably null
R1444:Pkd1l1 UTSW 11 8854386 missense probably damaging 1.00
R1445:Pkd1l1 UTSW 11 8870313 missense probably benign 0.00
R1463:Pkd1l1 UTSW 11 8916302 missense probably damaging 1.00
R1496:Pkd1l1 UTSW 11 8941077 missense possibly damaging 0.95
R1542:Pkd1l1 UTSW 11 8874179 missense possibly damaging 0.82
R1543:Pkd1l1 UTSW 11 8901200 missense probably damaging 1.00
R1619:Pkd1l1 UTSW 11 8950413 missense probably damaging 0.98
R1875:Pkd1l1 UTSW 11 8844670 splice site probably benign
R1929:Pkd1l1 UTSW 11 8836197 splice site probably benign
R1958:Pkd1l1 UTSW 11 8874161 missense probably benign 0.01
R2223:Pkd1l1 UTSW 11 8889063 missense probably benign 0.18
R2223:Pkd1l1 UTSW 11 8950422 missense probably benign
R2264:Pkd1l1 UTSW 11 8879112 missense probably damaging 0.97
R2349:Pkd1l1 UTSW 11 8826819 splice site probably null
R2431:Pkd1l1 UTSW 11 8947197 missense probably damaging 0.99
R2483:Pkd1l1 UTSW 11 8962701 missense probably damaging 1.00
R2517:Pkd1l1 UTSW 11 8958900 missense unknown
R2888:Pkd1l1 UTSW 11 8947251 missense probably damaging 1.00
R2965:Pkd1l1 UTSW 11 8874236 missense probably damaging 1.00
R3123:Pkd1l1 UTSW 11 8973021 missense unknown
R3153:Pkd1l1 UTSW 11 8867207 missense probably benign 0.01
R3840:Pkd1l1 UTSW 11 8889050 missense probably damaging 1.00
R3855:Pkd1l1 UTSW 11 8965047 critical splice donor site probably null
R3880:Pkd1l1 UTSW 11 8961983 missense unknown
R3970:Pkd1l1 UTSW 11 8874218 missense probably damaging 1.00
R4195:Pkd1l1 UTSW 11 8909929 missense probably damaging 1.00
R4196:Pkd1l1 UTSW 11 8909929 missense probably damaging 1.00
R4246:Pkd1l1 UTSW 11 8865543 missense possibly damaging 0.51
R4247:Pkd1l1 UTSW 11 8865543 missense possibly damaging 0.51
R4249:Pkd1l1 UTSW 11 8865543 missense possibly damaging 0.51
R4250:Pkd1l1 UTSW 11 8865543 missense possibly damaging 0.51
R4593:Pkd1l1 UTSW 11 8901253 missense probably damaging 0.97
R4609:Pkd1l1 UTSW 11 8958964 missense unknown
R4797:Pkd1l1 UTSW 11 8961340 missense unknown
R4910:Pkd1l1 UTSW 11 8929360 missense possibly damaging 0.50
R4940:Pkd1l1 UTSW 11 8844585 missense probably benign
R5084:Pkd1l1 UTSW 11 8942004 missense probably benign 0.05
R5147:Pkd1l1 UTSW 11 8849003 missense possibly damaging 0.71
R5360:Pkd1l1 UTSW 11 8879204 missense probably benign
R5483:Pkd1l1 UTSW 11 8901141 critical splice donor site probably null
R5604:Pkd1l1 UTSW 11 8833877 missense probably damaging 0.98
R5642:Pkd1l1 UTSW 11 8879202 missense probably damaging 1.00
R5652:Pkd1l1 UTSW 11 8909889 missense probably benign 0.03
R5751:Pkd1l1 UTSW 11 8867204 missense possibly damaging 0.45
R5761:Pkd1l1 UTSW 11 8916301 missense probably damaging 1.00
R5800:Pkd1l1 UTSW 11 8861302 missense probably benign
R5874:Pkd1l1 UTSW 11 8908688 missense probably damaging 1.00
R5897:Pkd1l1 UTSW 11 8879176 missense probably benign 0.03
R5913:Pkd1l1 UTSW 11 8863849 missense probably benign 0.00
R5930:Pkd1l1 UTSW 11 8958969 missense unknown
R6000:Pkd1l1 UTSW 11 8950427 missense probably benign 0.00
R6005:Pkd1l1 UTSW 11 8857113 missense probably damaging 1.00
R6013:Pkd1l1 UTSW 11 8869452 splice site probably null
R6027:Pkd1l1 UTSW 11 8916272 nonsense probably null
R6028:Pkd1l1 UTSW 11 8836267 missense probably benign 0.06
R6129:Pkd1l1 UTSW 11 8868543 missense probably benign 0.00
R6182:Pkd1l1 UTSW 11 8865555 missense probably benign 0.36
R6226:Pkd1l1 UTSW 11 8901287 missense probably benign 0.00
R6257:Pkd1l1 UTSW 11 8942195 missense probably benign 0.22
R6340:Pkd1l1 UTSW 11 8844649 missense probably benign 0.09
R6478:Pkd1l1 UTSW 11 8863911 missense probably benign 0.00
R6558:Pkd1l1 UTSW 11 8889052 missense probably benign 0.00
R6750:Pkd1l1 UTSW 11 8973217 missense unknown
R6987:Pkd1l1 UTSW 11 8902575 missense probably benign 0.01
R6996:Pkd1l1 UTSW 11 8849046 missense probably damaging 1.00
R7139:Pkd1l1 UTSW 11 8890737 missense
R7224:Pkd1l1 UTSW 11 8945241 missense
R7244:Pkd1l1 UTSW 11 8871771 missense
R7265:Pkd1l1 UTSW 11 8929402 missense
R7358:Pkd1l1 UTSW 11 8945202 missense
R7387:Pkd1l1 UTSW 11 8901203 missense
R7414:Pkd1l1 UTSW 11 8916267 missense
R7459:Pkd1l1 UTSW 11 8902428 missense
R7478:Pkd1l1 UTSW 11 8929441 missense
R7485:Pkd1l1 UTSW 11 8965148 missense
R7490:Pkd1l1 UTSW 11 8916265 missense
R7644:Pkd1l1 UTSW 11 8875758 missense
R7647:Pkd1l1 UTSW 11 8947296 missense
R7676:Pkd1l1 UTSW 11 8962708 missense
R7687:Pkd1l1 UTSW 11 8854390 missense
X0024:Pkd1l1 UTSW 11 8950413 missense probably benign 0.01
X0063:Pkd1l1 UTSW 11 8929430 missense probably damaging 0.96
X0065:Pkd1l1 UTSW 11 8909921 missense probably benign 0.10
Z1176:Pkd1l1 UTSW 11 8826801 missense
Z1177:Pkd1l1 UTSW 11 8945208 missense
Predicted Primers PCR Primer
(F):5'- TGCTCATCTGCTCTGACTAGGG -3'
(R):5'- ATGTGGAGGACAGTGGTCTC -3'

Sequencing Primer
(F):5'- CTCTGACTAGGGCAAGGGTAC -3'
(R):5'- ACAGTGGTCTCTGTGCCAG -3'
Posted On2020-01-23