Incidental Mutation 'R8052:Iqgap2'
ID 619133
Institutional Source Beutler Lab
Gene Symbol Iqgap2
Ensembl Gene ENSMUSG00000021676
Gene Name IQ motif containing GTPase activating protein 2
Synonyms 4933417J23Rik
MMRRC Submission 067489-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8052 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 95763685-96028788 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 95794387 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 1195 (D1195G)
Ref Sequence ENSEMBL: ENSMUSP00000067685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068603]
AlphaFold Q3UQ44
Predicted Effect probably damaging
Transcript: ENSMUST00000068603
AA Change: D1195G

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000067685
Gene: ENSMUSG00000021676
AA Change: D1195G

DomainStartEndE-ValueType
CH 43 152 3.32e-16 SMART
coiled coil region 253 276 N/A INTRINSIC
low complexity region 469 480 N/A INTRINSIC
IQ 689 711 1.38e-4 SMART
IQ 719 741 7.36e0 SMART
IQ 749 771 2.43e1 SMART
coiled coil region 799 828 N/A INTRINSIC
RasGAP 905 1258 2.6e-120 SMART
Pfam:RasGAP_C 1367 1498 3.2e-40 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IQGAP family. The protein contains three IQ domains, one calponin homology domain, one Ras-GAP domain and one WW domain. It interacts with components of the cytoskeleton, with cell adhesion molecules, and with several signaling molecules to regulate cell morphology and motility. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display reduced survival with increased incidence of hepatocellular carcinomas, increased hepatocyte apoptosis, and hepatocyte mitochondrial abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi1 T C 2: 22,843,555 (GRCm39) T297A probably benign Het
Acadl G T 1: 66,892,337 (GRCm39) T162K probably benign Het
Aldoart2 A T 12: 55,612,536 (GRCm39) I154F probably damaging Het
Alkbh8 G A 9: 3,385,478 (GRCm39) R625H probably damaging Het
Ankrd31 T A 13: 96,969,036 (GRCm39) V891E probably benign Het
Aopep G A 13: 63,216,065 (GRCm39) V446I probably damaging Het
Atp8b5 C T 4: 43,356,982 (GRCm39) R577* probably null Het
Capn3 G T 2: 120,316,867 (GRCm39) E285D probably benign Het
Cd79b G T 11: 106,204,526 (GRCm39) P87T probably damaging Het
Celsr2 T G 3: 108,319,971 (GRCm39) D947A probably damaging Het
Csmd3 A C 15: 47,569,783 (GRCm39) S1213R Het
Cyp2j5 T C 4: 96,552,241 (GRCm39) M3V probably benign Het
Ddi1 C T 9: 6,265,787 (GRCm39) R194K probably benign Het
Decr1 T C 4: 15,933,019 (GRCm39) K49R probably benign Het
Dnah10 A C 5: 124,905,575 (GRCm39) E4130A probably benign Het
Dst A G 1: 34,323,444 (GRCm39) D4648G probably damaging Het
Ecd A G 14: 20,380,020 (GRCm39) probably null Het
Erbin A T 13: 103,970,864 (GRCm39) Y917* probably null Het
Evpl T C 11: 116,113,989 (GRCm39) K1234E probably benign Het
F11r T A 1: 171,289,191 (GRCm39) Y218N possibly damaging Het
Fam43a C G 16: 30,420,622 (GRCm39) T402S probably benign Het
Frem2 T C 3: 53,457,064 (GRCm39) N2096S probably benign Het
Gpd2 T A 2: 57,196,962 (GRCm39) Y172* probably null Het
Hscb A G 5: 110,983,844 (GRCm39) V90A probably benign Het
Map2k2 T C 10: 80,950,900 (GRCm39) I115T probably damaging Het
Mast2 C T 4: 116,170,172 (GRCm39) R707H probably damaging Het
Mindy4 A G 6: 55,277,977 (GRCm39) N607S probably damaging Het
Mrpl9 T A 3: 94,351,050 (GRCm39) Y77N probably damaging Het
Muc16 G A 9: 18,570,347 (GRCm39) T724I unknown Het
Nat3 A T 8: 68,000,478 (GRCm39) Y119F possibly damaging Het
Nol7 T C 13: 43,554,990 (GRCm39) S208P probably damaging Het
Notch3 A T 17: 32,365,545 (GRCm39) C1056S probably damaging Het
Nup50l TCC TCCGCC 6: 96,142,078 (GRCm39) probably benign Het
Nup50l TCC TCCCCC 6: 96,142,084 (GRCm39) probably benign Het
Or13j1 A T 4: 43,705,884 (GRCm39) V228E probably damaging Het
Or3a4 T A 11: 73,945,301 (GRCm39) I95F probably benign Het
Or5al5 A T 2: 85,961,721 (GRCm39) Y95* probably null Het
Or8g17 G T 9: 38,930,783 (GRCm39) T18K probably damaging Het
Osbpl3 A C 6: 50,322,995 (GRCm39) L288R probably damaging Het
Oscp1 A C 4: 125,982,116 (GRCm39) D352A possibly damaging Het
Pcdh9 G A 14: 94,123,222 (GRCm39) R983C probably benign Het
Pcdhgb8 T C 18: 37,896,555 (GRCm39) S542P probably benign Het
Pi4ka T C 16: 17,174,030 (GRCm39) T490A Het
Pkd1l1 A T 11: 8,897,315 (GRCm39) D531E Het
Potefam3d A T 8: 69,975,404 (GRCm39) Y21N possibly damaging Het
Prr3 G T 17: 36,290,053 (GRCm39) D26E possibly damaging Het
Psmd8 T C 7: 28,880,001 (GRCm39) K24E probably benign Het
Rasgrp4 G A 7: 28,849,362 (GRCm39) C583Y probably damaging Het
Rest A G 5: 77,416,171 (GRCm39) I128M probably benign Het
Rftn1 A T 17: 50,393,607 (GRCm39) F144I probably damaging Het
Rusc2 T C 4: 43,421,851 (GRCm39) F757S probably benign Het
Ryr1 A G 7: 28,782,810 (GRCm39) S1942P probably benign Het
Sdk2 C T 11: 113,745,177 (GRCm39) R706Q probably damaging Het
Sergef G T 7: 46,264,062 (GRCm39) T275K probably damaging Het
Serpina10 T C 12: 103,594,569 (GRCm39) T217A probably damaging Het
Shd G C 17: 56,283,235 (GRCm39) S288T probably damaging Het
Siglec15 C A 18: 78,091,803 (GRCm39) A133S possibly damaging Het
Stat4 C T 1: 52,118,932 (GRCm39) P325L probably damaging Het
Syt8 G A 7: 141,993,881 (GRCm39) G344D probably damaging Het
Tes A G 6: 17,097,291 (GRCm39) E133G probably benign Het
Tmprss2 T C 16: 97,369,616 (GRCm39) Y386C probably damaging Het
Tnfrsf11b A T 15: 54,115,502 (GRCm39) L365Q probably damaging Het
Tns1 T A 1: 73,992,596 (GRCm39) D67V probably damaging Het
Tns2 T C 15: 102,021,280 (GRCm39) S982P probably damaging Het
Tpcn2 A T 7: 144,814,683 (GRCm39) F473I probably benign Het
Tsg101 A T 7: 46,542,257 (GRCm39) I232N probably damaging Het
Ttc3 T C 16: 94,268,848 (GRCm39) S1977P probably benign Het
Ttll11 T A 2: 35,869,527 (GRCm39) E37V unknown Het
Ttn A T 2: 76,649,160 (GRCm39) V12716E possibly damaging Het
Vmn2r70 A C 7: 85,212,923 (GRCm39) S495A probably benign Het
Zfp974 A G 7: 27,610,697 (GRCm39) C343R probably damaging Het
Zfy1 A T Y: 726,004 (GRCm39) I587N possibly damaging Het
Other mutations in Iqgap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00799:Iqgap2 APN 13 95,794,452 (GRCm39) splice site probably benign
IGL01968:Iqgap2 APN 13 95,772,090 (GRCm39) missense possibly damaging 0.80
IGL02049:Iqgap2 APN 13 95,811,913 (GRCm39) splice site probably benign
IGL02195:Iqgap2 APN 13 95,798,242 (GRCm39) splice site probably benign
IGL02387:Iqgap2 APN 13 95,826,209 (GRCm39) missense probably benign 0.00
IGL02634:Iqgap2 APN 13 95,764,622 (GRCm39) missense probably damaging 1.00
IGL02666:Iqgap2 APN 13 95,764,564 (GRCm39) missense probably damaging 1.00
IGL02685:Iqgap2 APN 13 95,807,912 (GRCm39) missense probably damaging 1.00
IGL02927:Iqgap2 APN 13 95,861,184 (GRCm39) missense possibly damaging 0.62
IGL02943:Iqgap2 APN 13 95,798,243 (GRCm39) splice site probably benign
IGL03167:Iqgap2 APN 13 95,821,406 (GRCm39) missense probably benign 0.34
IGL03169:Iqgap2 APN 13 95,867,785 (GRCm39) splice site probably null
IGL03293:Iqgap2 APN 13 95,867,942 (GRCm39) missense probably damaging 1.00
G1Funyon:Iqgap2 UTSW 13 95,818,659 (GRCm39) critical splice donor site probably null
R0257:Iqgap2 UTSW 13 95,861,052 (GRCm39) critical splice donor site probably null
R0335:Iqgap2 UTSW 13 95,772,141 (GRCm39) missense probably damaging 0.99
R0360:Iqgap2 UTSW 13 95,867,783 (GRCm39) splice site probably benign
R0364:Iqgap2 UTSW 13 95,867,783 (GRCm39) splice site probably benign
R0419:Iqgap2 UTSW 13 95,826,207 (GRCm39) critical splice donor site probably null
R1229:Iqgap2 UTSW 13 95,768,673 (GRCm39) missense probably benign 0.32
R1290:Iqgap2 UTSW 13 95,805,021 (GRCm39) missense probably damaging 1.00
R1397:Iqgap2 UTSW 13 95,768,673 (GRCm39) missense probably benign 0.32
R1498:Iqgap2 UTSW 13 95,783,313 (GRCm39) missense probably benign
R1513:Iqgap2 UTSW 13 95,766,518 (GRCm39) missense probably damaging 1.00
R1630:Iqgap2 UTSW 13 95,826,293 (GRCm39) missense probably benign
R2088:Iqgap2 UTSW 13 96,028,171 (GRCm39) critical splice donor site probably null
R2928:Iqgap2 UTSW 13 95,818,744 (GRCm39) missense probably benign
R3026:Iqgap2 UTSW 13 95,809,564 (GRCm39) critical splice acceptor site probably null
R3720:Iqgap2 UTSW 13 95,805,036 (GRCm39) splice site probably null
R3846:Iqgap2 UTSW 13 95,810,186 (GRCm39) splice site probably benign
R4056:Iqgap2 UTSW 13 95,886,541 (GRCm39) missense probably damaging 1.00
R4077:Iqgap2 UTSW 13 95,794,375 (GRCm39) missense probably damaging 1.00
R4353:Iqgap2 UTSW 13 95,807,904 (GRCm39) missense probably damaging 1.00
R4517:Iqgap2 UTSW 13 95,800,569 (GRCm39) critical splice donor site probably null
R4628:Iqgap2 UTSW 13 95,899,837 (GRCm39) missense probably benign 0.17
R4686:Iqgap2 UTSW 13 95,858,117 (GRCm39) missense probably damaging 0.98
R4724:Iqgap2 UTSW 13 95,772,005 (GRCm39) missense possibly damaging 0.73
R4826:Iqgap2 UTSW 13 95,899,783 (GRCm39) missense probably damaging 1.00
R4847:Iqgap2 UTSW 13 95,810,251 (GRCm39) missense probably benign 0.19
R4967:Iqgap2 UTSW 13 95,766,514 (GRCm39) missense probably benign 0.00
R4973:Iqgap2 UTSW 13 95,794,305 (GRCm39) splice site probably null
R5010:Iqgap2 UTSW 13 95,810,251 (GRCm39) missense probably benign 0.19
R5086:Iqgap2 UTSW 13 95,772,088 (GRCm39) missense probably benign 0.01
R5496:Iqgap2 UTSW 13 95,766,561 (GRCm39) missense probably damaging 1.00
R5512:Iqgap2 UTSW 13 95,811,884 (GRCm39) nonsense probably null
R5629:Iqgap2 UTSW 13 95,768,682 (GRCm39) missense probably damaging 1.00
R5824:Iqgap2 UTSW 13 95,811,880 (GRCm39) missense probably damaging 0.99
R5830:Iqgap2 UTSW 13 95,811,880 (GRCm39) missense probably damaging 0.99
R5831:Iqgap2 UTSW 13 95,811,880 (GRCm39) missense probably damaging 0.99
R5832:Iqgap2 UTSW 13 95,811,880 (GRCm39) missense probably damaging 0.99
R5833:Iqgap2 UTSW 13 95,811,880 (GRCm39) missense probably damaging 0.99
R5834:Iqgap2 UTSW 13 95,811,880 (GRCm39) missense probably damaging 0.99
R5852:Iqgap2 UTSW 13 95,811,880 (GRCm39) missense probably damaging 0.99
R5888:Iqgap2 UTSW 13 95,772,118 (GRCm39) missense possibly damaging 0.89
R5889:Iqgap2 UTSW 13 95,768,550 (GRCm39) missense probably benign 0.00
R6093:Iqgap2 UTSW 13 95,765,471 (GRCm39) missense probably damaging 0.99
R6141:Iqgap2 UTSW 13 95,858,194 (GRCm39) splice site probably null
R6404:Iqgap2 UTSW 13 95,865,985 (GRCm39) missense probably benign 0.28
R6434:Iqgap2 UTSW 13 95,819,441 (GRCm39) missense possibly damaging 0.85
R6648:Iqgap2 UTSW 13 95,818,719 (GRCm39) missense probably benign 0.27
R6658:Iqgap2 UTSW 13 95,796,840 (GRCm39) missense probably damaging 1.00
R6903:Iqgap2 UTSW 13 95,797,565 (GRCm39) missense probably damaging 1.00
R7223:Iqgap2 UTSW 13 95,765,480 (GRCm39) missense probably damaging 1.00
R7327:Iqgap2 UTSW 13 95,772,163 (GRCm39) missense probably benign 0.00
R7371:Iqgap2 UTSW 13 95,836,846 (GRCm39) splice site probably null
R7378:Iqgap2 UTSW 13 95,869,398 (GRCm39) critical splice donor site probably null
R7441:Iqgap2 UTSW 13 95,764,584 (GRCm39) missense probably benign 0.23
R7575:Iqgap2 UTSW 13 95,798,131 (GRCm39) missense probably damaging 0.99
R7671:Iqgap2 UTSW 13 95,764,627 (GRCm39) missense probably damaging 0.98
R7713:Iqgap2 UTSW 13 95,867,952 (GRCm39) missense probably benign 0.01
R7806:Iqgap2 UTSW 13 95,818,765 (GRCm39) missense probably benign 0.00
R7893:Iqgap2 UTSW 13 95,826,217 (GRCm39) missense probably damaging 0.96
R8121:Iqgap2 UTSW 13 95,861,076 (GRCm39) missense probably benign 0.00
R8261:Iqgap2 UTSW 13 95,772,078 (GRCm39) missense probably damaging 1.00
R8301:Iqgap2 UTSW 13 95,818,659 (GRCm39) critical splice donor site probably null
R8369:Iqgap2 UTSW 13 95,798,111 (GRCm39) missense probably damaging 1.00
R8485:Iqgap2 UTSW 13 95,796,659 (GRCm39) missense probably damaging 0.99
R8709:Iqgap2 UTSW 13 95,796,713 (GRCm39) missense probably damaging 0.99
R8710:Iqgap2 UTSW 13 95,796,756 (GRCm39) missense probably benign 0.24
R8737:Iqgap2 UTSW 13 95,802,258 (GRCm39) missense probably damaging 1.00
R8845:Iqgap2 UTSW 13 95,794,392 (GRCm39) missense possibly damaging 0.60
R8902:Iqgap2 UTSW 13 95,818,711 (GRCm39) missense probably benign 0.16
R8957:Iqgap2 UTSW 13 95,772,154 (GRCm39) missense probably damaging 1.00
R9153:Iqgap2 UTSW 13 95,844,547 (GRCm39) missense probably benign
R9259:Iqgap2 UTSW 13 95,766,561 (GRCm39) missense probably damaging 1.00
R9290:Iqgap2 UTSW 13 95,886,523 (GRCm39) missense probably damaging 1.00
R9414:Iqgap2 UTSW 13 95,783,349 (GRCm39) missense
R9432:Iqgap2 UTSW 13 95,774,261 (GRCm39) missense probably benign
R9747:Iqgap2 UTSW 13 95,821,505 (GRCm39) missense probably damaging 1.00
X0066:Iqgap2 UTSW 13 95,807,891 (GRCm39) missense probably damaging 0.98
Z1176:Iqgap2 UTSW 13 95,867,951 (GRCm39) missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CAAGCGCACAGGCAATTTC -3'
(R):5'- GTCCAGCATCCAGAAACATGG -3'

Sequencing Primer
(F):5'- CAATTTCTGCTGGGACTAGGCAC -3'
(R):5'- CCCTGGAAGATGCTAACAAGTGC -3'
Posted On 2020-01-23