Incidental Mutation 'R8052:Notch3'
ID619145
Institutional Source Beutler Lab
Gene Symbol Notch3
Ensembl Gene ENSMUSG00000038146
Gene Namenotch 3
SynonymsN3, hpbk
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8052 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location32120820-32166880 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 32146571 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 1056 (C1056S)
Ref Sequence ENSEMBL: ENSMUSP00000085016 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087723]
Predicted Effect probably damaging
Transcript: ENSMUST00000087723
AA Change: C1056S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000085016
Gene: ENSMUSG00000038146
AA Change: C1056S

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
EGF 42 78 3.73e-5 SMART
EGF 82 119 1.78e-2 SMART
EGF 123 157 1.13e-4 SMART
EGF_CA 159 196 1.89e-15 SMART
EGF 201 235 3.85e-7 SMART
EGF_CA 237 273 3.97e-9 SMART
EGF_CA 275 313 4.63e-10 SMART
EGF_CA 315 351 1.05e-8 SMART
EGF 355 390 1.28e-3 SMART
EGF_CA 392 430 6.29e-12 SMART
EGF_CA 432 468 1.11e-12 SMART
EGF_CA 470 506 4.21e-13 SMART
EGF_CA 508 544 8.43e-13 SMART
EGF_CA 546 581 9.54e-12 SMART
EGF_CA 583 619 1.31e-9 SMART
EGF_CA 621 656 2.03e-6 SMART
EGF_CA 658 694 2.28e-9 SMART
EGF 699 731 7.18e-7 SMART
EGF 738 771 2.5e-6 SMART
EGF 775 809 8e-5 SMART
EGF_CA 811 848 4.77e-12 SMART
EGF_CA 850 886 3.81e-11 SMART
EGF_CA 888 923 1.47e-12 SMART
EGF_CA 925 961 3.4e-8 SMART
EGF 966 999 5.74e-6 SMART
EGF 1004 1035 7.18e-7 SMART
EGF 1040 1083 1.21e-4 SMART
EGF_CA 1085 1121 1.29e-8 SMART
EGF_CA 1123 1159 1.45e-11 SMART
EGF_CA 1161 1204 1.26e-11 SMART
EGF 1209 1245 1.53e-1 SMART
EGF 1250 1288 8e-5 SMART
EGF 1293 1326 1.13e1 SMART
EGF 1339 1374 5.36e-6 SMART
NL 1381 1419 1.63e-15 SMART
NL 1422 1460 1.78e-16 SMART
NL 1461 1502 1.75e-15 SMART
NOD 1506 1562 2.98e-24 SMART
NODP 1577 1641 1.34e-26 SMART
transmembrane domain 1644 1666 N/A INTRINSIC
low complexity region 1774 1783 N/A INTRINSIC
ANK 1789 1834 1.48e3 SMART
ANK 1839 1868 1.61e-4 SMART
ANK 1872 1902 1.42e0 SMART
ANK 1906 1935 1.77e-1 SMART
ANK 1939 1968 3.18e-3 SMART
ANK 1972 2001 5.16e-3 SMART
low complexity region 2028 2054 N/A INTRINSIC
low complexity region 2108 2123 N/A INTRINSIC
low complexity region 2169 2193 N/A INTRINSIC
DUF3454 2218 2275 2.81e-20 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the third discovered human homologue of the Drosophilia melanogaster type I membrane protein notch. In Drosophilia, notch interaction with its cell-bound ligands (delta, serrate) establishes an intercellular signalling pathway that plays a key role in neural development. Homologues of the notch-ligands have also been identified in human, but precise interactions between these ligands and the human notch homologues remains to be determined. Mutations in NOTCH3 have been identified as the underlying cause of cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy (CADASIL). [provided by RefSeq, Jul 2008]
PHENOTYPE: Some, but not all, null alleles cause defects in artery morphology and in T cell development. Progressive emaciation and kyphosis with paraphimosis occurs in an intron 31 splice donor site point mutant. In conjunction with Notch1 deficiency, abnormalities in embryonic development have been observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik TCC TCCGCC 6: 96,165,097 probably benign Het
1700123L14Rik TCC TCCCCC 6: 96,165,103 probably benign Het
2010111I01Rik G A 13: 63,068,251 V446I probably damaging Het
Abi1 T C 2: 22,953,543 T297A probably benign Het
Acadl G T 1: 66,853,178 T162K probably benign Het
Aldoart2 A T 12: 55,565,751 I154F probably damaging Het
Alkbh8 G A 9: 3,385,478 R625H probably damaging Het
Ankrd31 T A 13: 96,832,528 V891E probably benign Het
Atp8b5 C T 4: 43,356,982 R577* probably null Het
Capn3 G T 2: 120,486,386 E285D probably benign Het
Cd79b G T 11: 106,313,700 P87T probably damaging Het
Celsr2 T G 3: 108,412,655 D947A probably damaging Het
Csmd3 A C 15: 47,706,387 S1213R Het
Cyp2j5 T C 4: 96,664,004 M3V probably benign Het
Ddi1 C T 9: 6,265,787 R194K probably benign Het
Decr1 T C 4: 15,933,019 K49R probably benign Het
Dnah10 A C 5: 124,828,511 E4130A probably benign Het
Dst A G 1: 34,284,363 D4648G probably damaging Het
Ecd A G 14: 20,329,952 probably null Het
Erbin A T 13: 103,834,356 Y917* probably null Het
Evpl T C 11: 116,223,163 K1234E probably benign Het
F11r T A 1: 171,461,623 Y218N possibly damaging Het
Fam43a C G 16: 30,601,804 T402S probably benign Het
Frem2 T C 3: 53,549,643 N2096S probably benign Het
Gm7697 A T 8: 69,522,752 Y21N possibly damaging Het
Gpd2 T A 2: 57,306,950 Y172* probably null Het
Hscb A G 5: 110,835,978 V90A probably benign Het
Iqgap2 T C 13: 95,657,879 D1195G probably damaging Het
Map2k2 T C 10: 81,115,066 I115T probably damaging Het
Mast2 C T 4: 116,312,975 R707H probably damaging Het
Mindy4 A G 6: 55,300,992 N607S probably damaging Het
Mrpl9 T A 3: 94,443,743 Y77N probably damaging Het
Muc16 G A 9: 18,659,051 T724I unknown Het
Nat3 A T 8: 67,547,826 Y119F possibly damaging Het
Nol7 T C 13: 43,401,514 S208P probably damaging Het
Olfr1039 A T 2: 86,131,377 Y95* probably null Het
Olfr146 G T 9: 39,019,487 T18K probably damaging Het
Olfr399 T A 11: 74,054,475 I95F probably benign Het
Olfr71 A T 4: 43,705,884 V228E probably damaging Het
Osbpl3 A C 6: 50,346,015 L288R probably damaging Het
Oscp1 A C 4: 126,088,323 D352A possibly damaging Het
Pcdh9 G A 14: 93,885,786 R983C probably benign Het
Pcdhgb8 T C 18: 37,763,502 S542P probably benign Het
Pi4ka T C 16: 17,356,166 T490A Het
Pkd1l1 A T 11: 8,947,315 D531E Het
Prr3 G T 17: 35,979,161 D26E possibly damaging Het
Psmd8 T C 7: 29,180,576 K24E probably benign Het
Rasgrp4 G A 7: 29,149,937 C583Y probably damaging Het
Rest A G 5: 77,268,324 I128M probably benign Het
Rftn1 A T 17: 50,086,579 F144I probably damaging Het
Rusc2 T C 4: 43,421,851 F757S probably benign Het
Ryr1 A G 7: 29,083,385 S1942P probably benign Het
Sdk2 C T 11: 113,854,351 R706Q probably damaging Het
Sergef G T 7: 46,614,638 T275K probably damaging Het
Serpina10 T C 12: 103,628,310 T217A probably damaging Het
Shd G C 17: 55,976,235 S288T probably damaging Het
Siglec15 C A 18: 78,048,588 A133S possibly damaging Het
Stat4 C T 1: 52,079,773 P325L probably damaging Het
Syt8 G A 7: 142,440,144 G344D probably damaging Het
Tes A G 6: 17,097,292 E133G probably benign Het
Tmprss2 T C 16: 97,568,416 Y386C probably damaging Het
Tnfrsf11b A T 15: 54,252,106 L365Q probably damaging Het
Tns1 T A 1: 73,953,437 D67V probably damaging Het
Tns2 T C 15: 102,112,845 S982P probably damaging Het
Tpcn2 A T 7: 145,260,946 F473I probably benign Het
Tsg101 A T 7: 46,892,509 I232N probably damaging Het
Ttc3 T C 16: 94,467,989 S1977P probably benign Het
Ttll11 T A 2: 35,979,515 E37V unknown Het
Ttn A T 2: 76,818,816 V12716E possibly damaging Het
Vmn2r70 A C 7: 85,563,715 S495A probably benign Het
Zfp974 A G 7: 27,911,272 C343R probably damaging Het
Zfy1 A T Y: 726,004 I587N possibly damaging Het
Other mutations in Notch3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Notch3 APN 17 32158114 nonsense probably null
IGL01065:Notch3 APN 17 32146416 nonsense probably null
IGL01296:Notch3 APN 17 32166757 missense unknown
IGL01322:Notch3 APN 17 32144471 missense probably damaging 1.00
IGL01343:Notch3 APN 17 32143436 missense probably benign 0.10
IGL01358:Notch3 APN 17 32144747 missense probably damaging 1.00
IGL01600:Notch3 APN 17 32144498 missense probably damaging 1.00
IGL01622:Notch3 APN 17 32158870 missense possibly damaging 0.50
IGL01623:Notch3 APN 17 32158870 missense possibly damaging 0.50
IGL01971:Notch3 APN 17 32124347 missense probably damaging 1.00
IGL02000:Notch3 APN 17 32122742 missense probably damaging 0.99
IGL02072:Notch3 APN 17 32147074 nonsense probably null
IGL02145:Notch3 APN 17 32154741 missense probably benign 0.01
IGL02256:Notch3 APN 17 32132324 missense probably damaging 1.00
IGL02366:Notch3 APN 17 32144205 missense probably benign
IGL02476:Notch3 APN 17 32158638 missense possibly damaging 0.67
IGL02502:Notch3 APN 17 32158278 nonsense probably null
IGL02551:Notch3 APN 17 32154731 splice site probably benign
divide UTSW 17 32137813 splice site probably null
Lopressor UTSW 17 32153884 missense probably damaging 1.00
marginal UTSW 17 32164224 missense probably benign
PIT4486001:Notch3 UTSW 17 32154763 missense probably damaging 1.00
R0115:Notch3 UTSW 17 32133462 missense possibly damaging 0.82
R0201:Notch3 UTSW 17 32156148 splice site probably benign
R0630:Notch3 UTSW 17 32147472 splice site probably benign
R1167:Notch3 UTSW 17 32122745 missense possibly damaging 0.95
R1432:Notch3 UTSW 17 32164224 missense probably benign
R1567:Notch3 UTSW 17 32158580 missense possibly damaging 0.77
R1623:Notch3 UTSW 17 32139191 missense probably benign 0.00
R1663:Notch3 UTSW 17 32156119 missense probably damaging 1.00
R1668:Notch3 UTSW 17 32158589 missense probably damaging 0.99
R1789:Notch3 UTSW 17 32158725 missense probably damaging 1.00
R1813:Notch3 UTSW 17 32143428 missense probably benign 0.08
R1837:Notch3 UTSW 17 32124322 missense probably damaging 1.00
R1896:Notch3 UTSW 17 32143428 missense probably benign 0.08
R1937:Notch3 UTSW 17 32153852 missense probably benign 0.03
R1954:Notch3 UTSW 17 32166678 missense probably benign
R2014:Notch3 UTSW 17 32158000 missense probably benign 0.00
R2058:Notch3 UTSW 17 32143644 missense probably benign
R2068:Notch3 UTSW 17 32135508 missense probably benign 0.00
R2097:Notch3 UTSW 17 32122754 missense probably damaging 1.00
R2112:Notch3 UTSW 17 32144610 missense probably benign 0.19
R2156:Notch3 UTSW 17 32147844 missense probably damaging 1.00
R2211:Notch3 UTSW 17 32147978 missense probably benign 0.00
R2324:Notch3 UTSW 17 32150134 splice site probably benign
R2432:Notch3 UTSW 17 32153804 missense probably damaging 1.00
R3117:Notch3 UTSW 17 32158115 missense probably damaging 1.00
R3236:Notch3 UTSW 17 32158461 missense probably damaging 0.96
R3409:Notch3 UTSW 17 32150702 missense possibly damaging 0.67
R3434:Notch3 UTSW 17 32158618 missense possibly damaging 0.80
R3435:Notch3 UTSW 17 32158618 missense possibly damaging 0.80
R3438:Notch3 UTSW 17 32153590 missense probably damaging 1.00
R3926:Notch3 UTSW 17 32153557 missense possibly damaging 0.92
R4087:Notch3 UTSW 17 32158113 missense possibly damaging 0.60
R4115:Notch3 UTSW 17 32158433 missense probably damaging 1.00
R4214:Notch3 UTSW 17 32132207 missense possibly damaging 0.96
R4234:Notch3 UTSW 17 32141341 missense probably damaging 0.97
R4242:Notch3 UTSW 17 32143745 missense possibly damaging 0.74
R4658:Notch3 UTSW 17 32154763 missense probably damaging 1.00
R4878:Notch3 UTSW 17 32147085 missense probably damaging 1.00
R4879:Notch3 UTSW 17 32147963 missense probably benign 0.00
R4885:Notch3 UTSW 17 32141377 missense probably damaging 0.98
R4924:Notch3 UTSW 17 32144731 missense probably damaging 1.00
R5084:Notch3 UTSW 17 32157890 critical splice donor site probably null
R5086:Notch3 UTSW 17 32143334 missense probably benign 0.13
R5343:Notch3 UTSW 17 32143283 missense probably benign 0.03
R5389:Notch3 UTSW 17 32139189 missense probably benign
R5503:Notch3 UTSW 17 32147055 missense probably benign 0.00
R5698:Notch3 UTSW 17 32157987 missense probably damaging 1.00
R5824:Notch3 UTSW 17 32153861 missense possibly damaging 0.92
R5969:Notch3 UTSW 17 32153884 missense probably damaging 1.00
R6050:Notch3 UTSW 17 32143527 missense probably benign
R6274:Notch3 UTSW 17 32147290 missense probably benign
R6276:Notch3 UTSW 17 32154749 missense probably benign 0.10
R6313:Notch3 UTSW 17 32151154 splice site probably null
R6316:Notch3 UTSW 17 32137813 splice site probably null
R6380:Notch3 UTSW 17 32144559 missense probably damaging 1.00
R6401:Notch3 UTSW 17 32158623 missense probably benign 0.01
R6502:Notch3 UTSW 17 32158217 missense probably damaging 1.00
R6741:Notch3 UTSW 17 32143484 missense probably benign 0.16
R7131:Notch3 UTSW 17 32144217 missense probably benign
R7140:Notch3 UTSW 17 32156377 missense possibly damaging 0.84
R7162:Notch3 UTSW 17 32146449 missense probably damaging 0.98
R7171:Notch3 UTSW 17 32158962 missense probably damaging 1.00
R7449:Notch3 UTSW 17 32157966 missense probably damaging 1.00
R7450:Notch3 UTSW 17 32141391 missense possibly damaging 0.69
R7554:Notch3 UTSW 17 32122371 missense probably benign 0.03
R7575:Notch3 UTSW 17 32154819 missense possibly damaging 0.81
R7632:Notch3 UTSW 17 32158506 missense probably benign
R7633:Notch3 UTSW 17 32158622 missense probably benign 0.17
R7860:Notch3 UTSW 17 32122773 missense possibly damaging 0.67
R8250:Notch3 UTSW 17 32132336 missense probably damaging 1.00
R8296:Notch3 UTSW 17 32122739 missense probably damaging 1.00
R8306:Notch3 UTSW 17 32158112 missense probably damaging 0.99
T0975:Notch3 UTSW 17 32146417 missense probably damaging 0.99
Z1088:Notch3 UTSW 17 32158652 missense possibly damaging 0.94
Z1176:Notch3 UTSW 17 32141516 missense probably benign 0.12
Z1176:Notch3 UTSW 17 32151370 missense probably damaging 1.00
Z1177:Notch3 UTSW 17 32166694 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCAAGCATGACTGACTTCTCTTC -3'
(R):5'- TGGTGCTGTGGAAAGAGACC -3'

Sequencing Primer
(F):5'- TCCCTGAGACGCACTTACC -3'
(R):5'- CCAGGTTAGCTGACAAGTGGC -3'
Posted On2020-01-23