Incidental Mutation 'R8052:Siglec15'
ID 619150
Institutional Source Beutler Lab
Gene Symbol Siglec15
Ensembl Gene ENSMUSG00000091055
Gene Name sialic acid binding Ig-like lectin 15
Synonyms Cd33l3, EG620235
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8052 (G1)
Quality Score 220.009
Status Not validated
Chromosome 18
Chromosomal Location 78043614-78057395 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 78048588 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Serine at position 133 (A133S)
Ref Sequence ENSEMBL: ENSMUSP00000126901 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170760]
AlphaFold A7E1W8
Predicted Effect possibly damaging
Transcript: ENSMUST00000170760
AA Change: A133S

PolyPhen 2 Score 0.456 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000126901
Gene: ENSMUSG00000091055
AA Change: A133S

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IG 49 165 8.51e-7 SMART
SCOP:d1wwca_ 167 258 8e-10 SMART
Blast:IG_like 171 254 1e-47 BLAST
transmembrane domain 260 282 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted allele exhibit impaired osteoclast differentiation and function and mild osteopetrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik TCC TCCGCC 6: 96,165,097 probably benign Het
1700123L14Rik TCC TCCCCC 6: 96,165,103 probably benign Het
2010111I01Rik G A 13: 63,068,251 V446I probably damaging Het
Abi1 T C 2: 22,953,543 T297A probably benign Het
Acadl G T 1: 66,853,178 T162K probably benign Het
Aldoart2 A T 12: 55,565,751 I154F probably damaging Het
Alkbh8 G A 9: 3,385,478 R625H probably damaging Het
Ankrd31 T A 13: 96,832,528 V891E probably benign Het
Atp8b5 C T 4: 43,356,982 R577* probably null Het
Capn3 G T 2: 120,486,386 E285D probably benign Het
Cd79b G T 11: 106,313,700 P87T probably damaging Het
Celsr2 T G 3: 108,412,655 D947A probably damaging Het
Csmd3 A C 15: 47,706,387 S1213R Het
Cyp2j5 T C 4: 96,664,004 M3V probably benign Het
Ddi1 C T 9: 6,265,787 R194K probably benign Het
Decr1 T C 4: 15,933,019 K49R probably benign Het
Dnah10 A C 5: 124,828,511 E4130A probably benign Het
Dst A G 1: 34,284,363 D4648G probably damaging Het
Ecd A G 14: 20,329,952 probably null Het
Erbin A T 13: 103,834,356 Y917* probably null Het
Evpl T C 11: 116,223,163 K1234E probably benign Het
F11r T A 1: 171,461,623 Y218N possibly damaging Het
Fam43a C G 16: 30,601,804 T402S probably benign Het
Frem2 T C 3: 53,549,643 N2096S probably benign Het
Gm7697 A T 8: 69,522,752 Y21N possibly damaging Het
Gpd2 T A 2: 57,306,950 Y172* probably null Het
Hscb A G 5: 110,835,978 V90A probably benign Het
Iqgap2 T C 13: 95,657,879 D1195G probably damaging Het
Map2k2 T C 10: 81,115,066 I115T probably damaging Het
Mast2 C T 4: 116,312,975 R707H probably damaging Het
Mindy4 A G 6: 55,300,992 N607S probably damaging Het
Mrpl9 T A 3: 94,443,743 Y77N probably damaging Het
Muc16 G A 9: 18,659,051 T724I unknown Het
Nat3 A T 8: 67,547,826 Y119F possibly damaging Het
Nol7 T C 13: 43,401,514 S208P probably damaging Het
Notch3 A T 17: 32,146,571 C1056S probably damaging Het
Olfr1039 A T 2: 86,131,377 Y95* probably null Het
Olfr146 G T 9: 39,019,487 T18K probably damaging Het
Olfr399 T A 11: 74,054,475 I95F probably benign Het
Olfr71 A T 4: 43,705,884 V228E probably damaging Het
Osbpl3 A C 6: 50,346,015 L288R probably damaging Het
Oscp1 A C 4: 126,088,323 D352A possibly damaging Het
Pcdh9 G A 14: 93,885,786 R983C probably benign Het
Pcdhgb8 T C 18: 37,763,502 S542P probably benign Het
Pi4ka T C 16: 17,356,166 T490A Het
Pkd1l1 A T 11: 8,947,315 D531E Het
Prr3 G T 17: 35,979,161 D26E possibly damaging Het
Psmd8 T C 7: 29,180,576 K24E probably benign Het
Rasgrp4 G A 7: 29,149,937 C583Y probably damaging Het
Rest A G 5: 77,268,324 I128M probably benign Het
Rftn1 A T 17: 50,086,579 F144I probably damaging Het
Rusc2 T C 4: 43,421,851 F757S probably benign Het
Ryr1 A G 7: 29,083,385 S1942P probably benign Het
Sdk2 C T 11: 113,854,351 R706Q probably damaging Het
Sergef G T 7: 46,614,638 T275K probably damaging Het
Serpina10 T C 12: 103,628,310 T217A probably damaging Het
Shd G C 17: 55,976,235 S288T probably damaging Het
Stat4 C T 1: 52,079,773 P325L probably damaging Het
Syt8 G A 7: 142,440,144 G344D probably damaging Het
Tes A G 6: 17,097,292 E133G probably benign Het
Tmprss2 T C 16: 97,568,416 Y386C probably damaging Het
Tnfrsf11b A T 15: 54,252,106 L365Q probably damaging Het
Tns1 T A 1: 73,953,437 D67V probably damaging Het
Tns2 T C 15: 102,112,845 S982P probably damaging Het
Tpcn2 A T 7: 145,260,946 F473I probably benign Het
Tsg101 A T 7: 46,892,509 I232N probably damaging Het
Ttc3 T C 16: 94,467,989 S1977P probably benign Het
Ttll11 T A 2: 35,979,515 E37V unknown Het
Ttn A T 2: 76,818,816 V12716E possibly damaging Het
Vmn2r70 A C 7: 85,563,715 S495A probably benign Het
Zfp974 A G 7: 27,911,272 C343R probably damaging Het
Zfy1 A T Y: 726,004 I587N possibly damaging Het
Other mutations in Siglec15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01743:Siglec15 APN 18 78043605 unclassified probably benign
IGL02472:Siglec15 APN 18 78043617 missense possibly damaging 0.72
IGL02988:Siglec15 UTSW 18 78049247 missense probably damaging 1.00
PIT4377001:Siglec15 UTSW 18 78057375 start gained probably benign
R0040:Siglec15 UTSW 18 78048877 splice site probably benign
R0607:Siglec15 UTSW 18 78046137 missense probably benign 0.03
R4427:Siglec15 UTSW 18 78043621 missense possibly damaging 0.53
R5023:Siglec15 UTSW 18 78048675 missense probably damaging 1.00
R5994:Siglec15 UTSW 18 78047375 missense probably damaging 1.00
R7052:Siglec15 UTSW 18 78048731 missense probably damaging 1.00
R7807:Siglec15 UTSW 18 78047481 missense probably damaging 1.00
R7827:Siglec15 UTSW 18 78057230 nonsense probably null
R7898:Siglec15 UTSW 18 78043699 missense probably benign 0.19
R9077:Siglec15 UTSW 18 78048768 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- AGTACGCTCTCGGGAATGTG -3'
(R):5'- CCCTATGCTAAGTCTGATGTGTC -3'

Sequencing Primer
(F):5'- CTCTCGGGAATGTGGGGGAAG -3'
(R):5'- AAGTCTGATGTGTCTCTGGCCC -3'
Posted On 2020-01-23