Incidental Mutation 'R8053:Cntnap5b'
ID619157
Institutional Source Beutler Lab
Gene Symbol Cntnap5b
Ensembl Gene ENSMUSG00000067028
Gene Namecontactin associated protein-like 5B
SynonymsCaspr5-2, C230078M14Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock #R8053 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location99772765-100485942 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 100390677 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 683 (L683Q)
Ref Sequence ENSEMBL: ENSMUSP00000139877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086738] [ENSMUST00000188735]
Predicted Effect possibly damaging
Transcript: ENSMUST00000086738
AA Change: L1054Q

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000083944
Gene: ENSMUSG00000067028
AA Change: L1054Q

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
FA58C 39 174 2.76e-16 SMART
LamG 201 338 2.84e-27 SMART
LamG 387 521 9.22e-27 SMART
EGF 549 583 1.14e0 SMART
Blast:FBG 586 758 3e-66 BLAST
LamG 798 925 2.12e-26 SMART
EGF 946 982 1.51e0 SMART
LamG 1023 1159 2.14e-13 SMART
transmembrane domain 1227 1249 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000188735
AA Change: L683Q

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139877
Gene: ENSMUSG00000067028
AA Change: L683Q

DomainStartEndE-ValueType
LamG 73 207 5.9e-29 SMART
EGF 235 269 5.6e-3 SMART
Blast:FBG 272 402 2e-42 BLAST
LamG 415 554 2.5e-11 SMART
EGF 575 611 7.1e-3 SMART
LamG 652 788 1.4e-15 SMART
transmembrane domain 856 878 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A T 13: 63,190,531 K574* probably null Het
5730507C01Rik C T 12: 18,533,727 R263* probably null Het
Abca12 G A 1: 71,349,169 R181* probably null Het
Adar T C 3: 89,747,285 L908P probably damaging Het
Ankrd55 C T 13: 112,323,153 R94C probably damaging Het
Carf A T 1: 60,128,038 T177S probably benign Het
Ccdc162 C A 10: 41,644,581 G693V probably benign Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Chd4 G T 6: 125,128,816 E1799* probably null Het
Chrna3 T A 9: 55,015,390 N378I probably benign Het
Clec4a2 T C 6: 123,128,039 V96A probably benign Het
Crisp4 T A 1: 18,124,274 Q208L probably benign Het
Crocc A G 4: 141,042,919 probably null Het
Cyp2ab1 T C 16: 20,314,268 E192G probably benign Het
Daglb A G 5: 143,503,269 K627R probably benign Het
Desi2 G A 1: 178,237,916 W16* probably null Het
Dtx3l T C 16: 35,938,952 probably benign Het
Elf2 A G 3: 51,308,130 V53A possibly damaging Het
Eomes A G 9: 118,480,553 D325G probably damaging Het
Etl4 A T 2: 20,661,963 L60F probably damaging Het
Exoc4 A G 6: 33,332,256 D271G probably benign Het
F5 A G 1: 164,192,769 I938V probably benign Het
Fam49b T C 15: 63,941,983 D155G probably damaging Het
Fdxr T A 11: 115,269,839 K290M probably benign Het
Fgd5 G A 6: 91,989,444 S886N probably benign Het
Gm11595 G A 11: 99,772,128 S242F unknown Het
Gm14322 A T 2: 177,769,631 Q78L probably damaging Het
Gm8267 A T 14: 44,724,850 S38T possibly damaging Het
Gm884 T A 11: 103,604,566 K2809I unknown Het
Gpr75 A T 11: 30,891,559 T155S probably benign Het
Hectd3 T C 4: 117,000,858 S628P possibly damaging Het
Hrh2 A G 13: 54,214,085 T27A probably benign Het
Kif16b G A 2: 142,853,714 R157C probably damaging Het
Krt16 T C 11: 100,246,787 Y364C probably damaging Het
Map2k5 T A 9: 63,343,425 N95I probably benign Het
Melk A G 4: 44,318,109 Y170C probably damaging Het
Mthfd1 T A 12: 76,280,508 D123E probably damaging Het
Muc2 A T 7: 141,698,332 Y827F probably benign Het
Myh15 T A 16: 49,142,939 M1081K possibly damaging Het
Nbeal1 A G 1: 60,279,795 T1998A probably damaging Het
Neb T A 2: 52,286,017 T1477S possibly damaging Het
Nox4 C A 7: 87,370,047 P416Q probably damaging Het
Olfr1000 T C 2: 85,608,890 T7A probably damaging Het
Olfr1230 A T 2: 89,297,196 F25I possibly damaging Het
Olfr1328 A G 4: 118,934,111 S246P probably damaging Het
Olfr137 A T 17: 38,305,210 F84I probably benign Het
Olfr391-ps T C 11: 73,798,996 T254A probably benign Het
Pcdhga4 A G 18: 37,686,255 K286E probably benign Het
Pde10a A G 17: 8,974,772 T679A probably benign Het
Phc2 C T 4: 128,709,640 Q188* probably null Het
Pramef8 C A 4: 143,417,638 Q185K probably benign Het
Prdm15 A G 16: 97,835,607 M170T probably benign Het
Rab20 G T 8: 11,454,443 Q86K probably damaging Het
Rev1 T C 1: 38,063,141 I714V possibly damaging Het
Rexo2 A G 9: 48,475,118 probably null Het
Rnf213 A G 11: 119,402,647 K75E Het
Sdk2 C T 11: 113,854,351 R706Q probably damaging Het
Sema3c C T 5: 17,655,022 T95I probably benign Het
Sh3rf2 T A 18: 42,153,022 S527T probably damaging Het
Sis A T 3: 72,949,568 Y434* probably null Het
Slc16a6 G A 11: 109,458,569 T222I probably damaging Het
Smad6 A G 9: 64,020,507 L173P probably damaging Het
Sugct T A 13: 17,301,969 N310I probably damaging Het
Syne1 T A 10: 5,052,658 K259* probably null Het
Taar6 A G 10: 23,985,246 V134A possibly damaging Het
Tmem199 A G 11: 78,507,786 I184T possibly damaging Het
Tnrc18 G T 5: 142,750,630 D1530E unknown Het
Tnxb G A 17: 34,704,179 V2579M probably damaging Het
Vangl2 A G 1: 172,004,736 F518L probably damaging Het
Vmn2r40 T C 7: 8,908,246 T683A Het
Wapl C T 14: 34,692,321 T380I probably damaging Het
Zfp874b A T 13: 67,474,098 H360Q probably damaging Het
Other mutations in Cntnap5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Cntnap5b APN 1 100050754 missense probably damaging 1.00
IGL00477:Cntnap5b APN 1 100213743 missense probably damaging 0.97
IGL00505:Cntnap5b APN 1 100379161 missense possibly damaging 0.81
IGL00596:Cntnap5b APN 1 100379161 missense possibly damaging 0.81
IGL00846:Cntnap5b APN 1 100164223 missense probably damaging 1.00
IGL00895:Cntnap5b APN 1 100383585 missense probably damaging 0.98
IGL00948:Cntnap5b APN 1 100141357 missense probably benign 0.00
IGL01073:Cntnap5b APN 1 100076030 missense probably benign 0.08
IGL01523:Cntnap5b APN 1 100431779 missense probably benign 0.02
IGL01779:Cntnap5b APN 1 99967339 missense probably damaging 1.00
IGL02253:Cntnap5b APN 1 100164211 missense possibly damaging 0.75
IGL02628:Cntnap5b APN 1 100072069 missense probably damaging 0.97
R0166:Cntnap5b UTSW 1 100274361 missense probably benign 0.41
R0211:Cntnap5b UTSW 1 100478374 missense possibly damaging 0.82
R0281:Cntnap5b UTSW 1 100072153 missense probably benign 0.22
R0363:Cntnap5b UTSW 1 100274468 missense probably benign 0.01
R0514:Cntnap5b UTSW 1 99772786 missense probably benign
R0645:Cntnap5b UTSW 1 100072042 splice site probably benign
R0848:Cntnap5b UTSW 1 100255163 missense probably benign 0.22
R1006:Cntnap5b UTSW 1 100383617 missense probably benign 0.00
R1349:Cntnap5b UTSW 1 100164088 missense probably benign 0.09
R1372:Cntnap5b UTSW 1 100164088 missense probably benign 0.09
R1474:Cntnap5b UTSW 1 100072089 missense probably benign 0.25
R1681:Cntnap5b UTSW 1 100076107 missense probably damaging 0.98
R1727:Cntnap5b UTSW 1 100213744 missense possibly damaging 0.91
R1760:Cntnap5b UTSW 1 99772810 missense probably benign 0.05
R1777:Cntnap5b UTSW 1 100370078 missense probably benign 0.10
R1939:Cntnap5b UTSW 1 99967348 missense probably benign
R1988:Cntnap5b UTSW 1 100072140 missense possibly damaging 0.92
R2069:Cntnap5b UTSW 1 100358725 missense probably benign 0.04
R2113:Cntnap5b UTSW 1 100274415 missense probably benign
R2148:Cntnap5b UTSW 1 100383474 missense probably benign 0.01
R2158:Cntnap5b UTSW 1 100390572 missense probably damaging 1.00
R2223:Cntnap5b UTSW 1 100213687 missense probably damaging 1.00
R2350:Cntnap5b UTSW 1 100379126 missense probably damaging 1.00
R3840:Cntnap5b UTSW 1 100383477 missense possibly damaging 0.50
R4329:Cntnap5b UTSW 1 100072163 missense probably damaging 0.99
R4609:Cntnap5b UTSW 1 99772847 critical splice donor site probably null
R4799:Cntnap5b UTSW 1 100358725 missense probably benign 0.04
R5129:Cntnap5b UTSW 1 100379090 missense probably damaging 1.00
R5323:Cntnap5b UTSW 1 100383550 nonsense probably null
R5434:Cntnap5b UTSW 1 100072201 missense probably benign 0.02
R5579:Cntnap5b UTSW 1 100383395 nonsense probably null
R5579:Cntnap5b UTSW 1 100383399 missense probably benign 0.27
R5630:Cntnap5b UTSW 1 100072069 missense probably damaging 0.99
R5644:Cntnap5b UTSW 1 100383601 missense probably benign 0.00
R5761:Cntnap5b UTSW 1 100446894 missense probably damaging 1.00
R6042:Cntnap5b UTSW 1 100390592 missense probably benign
R6147:Cntnap5b UTSW 1 100050781 missense probably damaging 1.00
R6190:Cntnap5b UTSW 1 100379075 missense possibly damaging 0.80
R6248:Cntnap5b UTSW 1 100072102 missense probably benign 0.30
R6286:Cntnap5b UTSW 1 100255073 missense possibly damaging 0.82
R6306:Cntnap5b UTSW 1 100164146 missense probably damaging 1.00
R6336:Cntnap5b UTSW 1 100358669 missense probably benign 0.00
R6360:Cntnap5b UTSW 1 100431736 nonsense probably null
R6722:Cntnap5b UTSW 1 100478486 missense probably damaging 0.98
R6750:Cntnap5b UTSW 1 100274499 missense probably damaging 1.00
R6806:Cntnap5b UTSW 1 99940649 missense probably damaging 1.00
R6933:Cntnap5b UTSW 1 100383450 missense probably benign 0.01
R6957:Cntnap5b UTSW 1 100274472 missense probably benign 0.08
R6958:Cntnap5b UTSW 1 100274472 missense probably benign 0.08
R6959:Cntnap5b UTSW 1 100274472 missense probably benign 0.08
R6961:Cntnap5b UTSW 1 100274472 missense probably benign 0.08
R6962:Cntnap5b UTSW 1 100274472 missense probably benign 0.08
R7088:Cntnap5b UTSW 1 100160077 missense probably damaging 0.99
R7146:Cntnap5b UTSW 1 100050794 splice site probably null
R7165:Cntnap5b UTSW 1 100076162 missense possibly damaging 0.94
R7190:Cntnap5b UTSW 1 100431849 splice site probably null
R7376:Cntnap5b UTSW 1 99967269 missense possibly damaging 0.92
R7385:Cntnap5b UTSW 1 100379090 missense probably damaging 1.00
RF007:Cntnap5b UTSW 1 100164070 missense probably damaging 1.00
X0020:Cntnap5b UTSW 1 100431848 critical splice donor site probably null
Z1176:Cntnap5b UTSW 1 99967270 missense probably damaging 0.99
Z1176:Cntnap5b UTSW 1 100164228 missense possibly damaging 0.86
Z1176:Cntnap5b UTSW 1 100446840 missense probably benign 0.01
Z1177:Cntnap5b UTSW 1 100050706 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ATTCTGGGACCTCTGTTACATAC -3'
(R):5'- TAATTACTGCAAGACAATCACGGC -3'

Sequencing Primer
(F):5'- CATGTTTCAAGAACCATACCCGGTG -3'
(R):5'- ATCAAGTTGGACCTGGCA -3'
Posted On2020-01-23