Mutagenetix > Incidental Mutations

Incidental Mutation 'R0662:Tecpr2'

61918

Institutional Source

Beutler Lab

Gene Symbol

Tecpr2

Ensembl Gene

ENSMUSG00000021275

Gene Name

tectonin beta-propeller repeat containing 2

Synonyms

MMRRC Submission

038847-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0662 (G1)

Quality Score

119

Status

Not validated

Chromosome

Chromosomal Location

110889264-110972394 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 110896228 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 25 (T25A)

Ref Sequence

ENSEMBL: ENSMUSP00000126749 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000165978] [ENSMUST00000169597] [ENSMUST00000223210]

Predicted Effect

probably benign
Transcript: ENSMUST00000165978
AA Change: T25A

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000127949
Gene: ENSMUSG00000021275
AA Change: T25A

Domain	Start	End	E-Value	Type
WD40	21	61	8.52e1	SMART
WD40	65	105	2.54e2	SMART
WD40	113	155	2.49e-1	SMART
TECPR	280	314	9.81e0	SMART
TECPR	316	353	2.55e0	SMART
low complexity region	392	424	N/A	INTRINSIC
low complexity region	464	471	N/A	INTRINSIC
low complexity region	553	564	N/A	INTRINSIC
low complexity region	655	670	N/A	INTRINSIC
TECPR	814	850	2.28e2	SMART
TECPR	898	931	1.79e-1	SMART
TECPR	939	974	5.61e-3	SMART
TECPR	985	1023	1.55e-5	SMART
TECPR	1173	1208	1.29e-2	SMART
TECPR	1216	1255	2.82e-8	SMART
TECPR	1266	1308	1.05e-7	SMART
TECPR	1317	1351	1.42e-4	SMART
TECPR	1360	1394	5.03e-5	SMART
low complexity region	1414	1421	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000169597
AA Change: T25A

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000126749
Gene: ENSMUSG00000021275
AA Change: T25A

Domain	Start	End	E-Value	Type
WD40	21	61	8.52e1	SMART
WD40	65	105	2.54e2	SMART
WD40	113	155	2.49e-1	SMART
TECPR	280	314	9.81e0	SMART
TECPR	316	353	2.55e0	SMART
low complexity region	392	424	N/A	INTRINSIC
low complexity region	464	471	N/A	INTRINSIC
low complexity region	553	564	N/A	INTRINSIC
low complexity region	655	670	N/A	INTRINSIC
TECPR	814	850	2.28e2	SMART
TECPR	898	931	1.79e-1	SMART
TECPR	939	974	5.61e-3	SMART
TECPR	985	1023	1.55e-5	SMART
TECPR	1173	1208	1.29e-2	SMART
TECPR	1216	1255	2.82e-8	SMART
TECPR	1266	1308	1.05e-7	SMART
TECPR	1317	1351	1.42e-4	SMART
TECPR	1360	1394	5.03e-5	SMART
low complexity region	1414	1421	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000181233

Predicted Effect

probably benign
Transcript: ENSMUST00000223210
AA Change: T25A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223246

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 96.6%
20x: 91.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tectonin beta-propeller repeat-containing (TECPR) family, and contains both TECPR and tryptophan-aspartic acid repeat (WD repeat) domains. This gene has been implicated in autophagy, as reduced expression levels of this gene have been associated with impaired autophagy. Recessive mutations in this gene have been associated with a hereditary form of spastic paraparesis (HSP). HSP is characterized by progressive spasticity and paralysis of the legs. There is also some evidence linking mutations in this gene with birdshot chorioretinopathy (BSCR), which results in inflammation of the choroid and retina. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A1cf	T	C	19: 31,920,938	S241P	probably benign	Het
Ankrd53	G	T	6: 83,763,643	V83L	probably damaging	Het
Armcx2	G	A	X: 134,805,636	T416I	possibly damaging	Het
C4b	G	A	17: 34,730,888	R1441C	probably damaging	Het
Cacng3	T	C	7: 122,768,359	I154T	probably damaging	Het
Cand2	A	G	6: 115,787,210	D315G	probably benign	Het
Celsr2	A	T	3: 108,398,520	S2089R	probably damaging	Het
Chd9	A	C	8: 90,977,676	K247Q	probably damaging	Het
Chil1	A	C	1: 134,188,573	S263R	probably damaging	Het
Clec12b	A	C	6: 129,376,237	C262W	probably damaging	Het
Cpsf7	T	C	19: 10,526,008	M1T	probably null	Het
Cul3	T	C	1: 80,271,565	D597G	probably damaging	Het
Dcaf11	T	C	14: 55,565,507	V251A	possibly damaging	Het
Eno2	A	T	6: 124,763,811	F218I	probably damaging	Het
Frmd6	A	T	12: 70,899,444	R549*	probably null	Het
Fyb2	G	A	4: 104,995,698	S461N	possibly damaging	Het
Gm5709	A	T	3: 59,606,743		noncoding transcript	Het
Hormad1	T	C	3: 95,575,599	I132T	probably benign	Het
Itga7	G	T	10: 128,953,531	R981L	probably damaging	Het
Itgbl1	T	A	14: 123,827,894	N153K	probably damaging	Het
Itih1	T	C	14: 30,933,360	E626G	possibly damaging	Het
Kat6b	AGAGGAGGAGGAGGAGGAGGA	AGAGGAGGAGGAGGAGGA	14: 21,662,349		probably benign	Het
Kcna2	A	T	3: 107,105,401	T433S	probably benign	Het
Map4k5	A	G	12: 69,813,153	V673A	probably damaging	Het
Mmp27	T	A	9: 7,577,650	V281E	probably benign	Het
Nr2c1	A	T	10: 94,190,738	I492F	probably damaging	Het
Olfr131	A	G	17: 38,082,933	I15T	probably benign	Het
Olfr292	A	G	7: 86,694,630	Y58C	possibly damaging	Het
Olfr457	C	T	6: 42,471,774	V135M	possibly damaging	Het
Olfr703	A	T	7: 106,844,649	I13F	probably benign	Het
Olfr77	G	C	9: 19,920,500	C97S	probably damaging	Het
Olfr862	T	C	9: 19,883,952	M118V	probably benign	Het
Olfr911-ps1	T	A	9: 38,524,026	M98K	probably damaging	Het
Pank3	T	C	11: 35,778,650	M237T	probably damaging	Het
Plekhh1	A	G	12: 79,078,993	T1268A	probably benign	Het
Ptchd4	A	G	17: 42,502,576	Y456C	probably damaging	Het
Rhcg	C	T	7: 79,599,729	V310M	probably damaging	Het
Ryr1	A	T	7: 29,100,189	D906E	probably damaging	Het
Sez6l	A	T	5: 112,473,422	L262Q	probably damaging	Het
Shprh	G	A	10: 11,186,847	V1233I	probably damaging	Het
Slc3a1	A	G	17: 85,037,207	E267G	possibly damaging	Het
Slc5a5	T	A	8: 70,883,875	T616S	probably benign	Het
St5	G	T	7: 109,557,426	P39Q	probably damaging	Het
Syne3	T	G	12: 104,961,510	E318A	probably benign	Het
Ubxn1	T	A	19: 8,875,197		probably null	Het
Unc5b	C	A	10: 60,772,583	R616L	possibly damaging	Het
Ush2a	A	G	1: 188,351,093	T278A	probably benign	Het
Utp14b	A	G	1: 78,664,999	T205A	probably damaging	Het
Vmn1r219	T	C	13: 23,163,453	S271P	possibly damaging	Het
Vmn2r76	C	T	7: 86,230,370	V241M	probably benign	Het
Zbtb24	G	A	10: 41,462,279	G429D	probably damaging	Het
Zdhhc2	T	C	8: 40,447,098	S68P	probably damaging	Het
Zfp719	G	A	7: 43,584,254	M32I	possibly damaging	Het
Zfp975	T	C	7: 42,662,526	N221S	probably benign	Het

Other mutations in Tecpr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01114:Tecpr2	APN	12	110967779	missense	possibly damaging	0.67
IGL01759:Tecpr2	APN	12	110931392	utr 3 prime	probably benign
IGL02114:Tecpr2	APN	12	110968887	missense	probably damaging	1.00
IGL02813:Tecpr2	APN	12	110933192	missense	probably damaging	1.00
IGL02943:Tecpr2	APN	12	110967749	missense	probably benign
IGL03085:Tecpr2	APN	12	110954826	splice site	probably benign
IGL03290:Tecpr2	APN	12	110967833	missense	possibly damaging	0.65
R0362:Tecpr2	UTSW	12	110968940	missense	probably damaging	0.96
R0486:Tecpr2	UTSW	12	110896369	missense	probably benign	0.01
R0787:Tecpr2	UTSW	12	110946343	missense	probably benign	0.30
R1147:Tecpr2	UTSW	12	110941438	splice site	probably benign
R1454:Tecpr2	UTSW	12	110968953	missense	probably benign	0.00
R1513:Tecpr2	UTSW	12	110954800	missense	possibly damaging	0.94
R1567:Tecpr2	UTSW	12	110941596	critical splice donor site	probably null
R1569:Tecpr2	UTSW	12	110944887	critical splice donor site	probably null
R1818:Tecpr2	UTSW	12	110926454	missense	probably damaging	1.00
R1856:Tecpr2	UTSW	12	110933064	missense	probably benign
R1897:Tecpr2	UTSW	12	110933247	missense	probably benign
R1903:Tecpr2	UTSW	12	110947912	missense	probably damaging	0.98
R1939:Tecpr2	UTSW	12	110933169	missense	probably damaging	0.98
R1982:Tecpr2	UTSW	12	110954785	missense	probably benign	0.07
R2073:Tecpr2	UTSW	12	110968429	missense	possibly damaging	0.51
R2393:Tecpr2	UTSW	12	110926402	missense	probably damaging	0.99
R2443:Tecpr2	UTSW	12	110896325	missense	probably damaging	1.00
R2484:Tecpr2	UTSW	12	110933318	missense	probably benign
R4564:Tecpr2	UTSW	12	110954785	missense	probably benign	0.07
R4723:Tecpr2	UTSW	12	110932976	missense	probably benign	0.01
R4835:Tecpr2	UTSW	12	110954730	missense	probably benign	0.00
R4847:Tecpr2	UTSW	12	110939877	missense	probably damaging	1.00
R4911:Tecpr2	UTSW	12	110931487	missense	possibly damaging	0.74
R5179:Tecpr2	UTSW	12	110944693	missense	possibly damaging	0.63
R5266:Tecpr2	UTSW	12	110915402	missense	probably damaging	1.00
R5386:Tecpr2	UTSW	12	110915453	missense	probably damaging	1.00
R5486:Tecpr2	UTSW	12	110933015	missense	probably benign	0.03
R5490:Tecpr2	UTSW	12	110914684	missense	probably damaging	1.00
R5627:Tecpr2	UTSW	12	110941482	missense	probably damaging	0.97
R5836:Tecpr2	UTSW	12	110931511	missense	possibly damaging	0.76
R6052:Tecpr2	UTSW	12	110918891	missense	possibly damaging	0.89
R6084:Tecpr2	UTSW	12	110929109	missense	probably damaging	0.98
R6306:Tecpr2	UTSW	12	110944751	missense	probably damaging	1.00
R6563:Tecpr2	UTSW	12	110929087	missense	probably benign	0.00
R6936:Tecpr2	UTSW	12	110944863	missense	possibly damaging	0.83
R6977:Tecpr2	UTSW	12	110939766	missense	probably benign	0.17
R7110:Tecpr2	UTSW	12	110918972	missense	probably damaging	1.00
R7132:Tecpr2	UTSW	12	110915372	missense	probably damaging	0.97
R7353:Tecpr2	UTSW	12	110967844	missense	probably benign	0.06
R7362:Tecpr2	UTSW	12	110941476	missense	possibly damaging	0.85
R7366:Tecpr2	UTSW	12	110915480	critical splice donor site	probably null
R7404:Tecpr2	UTSW	12	110931604	missense	probably benign	0.00
R7478:Tecpr2	UTSW	12	110968439	missense	probably benign	0.36
R7774:Tecpr2	UTSW	12	110933172	missense	probably benign	0.00
R7997:Tecpr2	UTSW	12	110933603	missense	probably benign	0.02
R8037:Tecpr2	UTSW	12	110936420	missense	probably benign	0.03
R8038:Tecpr2	UTSW	12	110936420	missense	probably benign	0.03
Z1176:Tecpr2	UTSW	12	110896310	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGTGGGAGCTAGTCCTAACTGAAGTG -3'
(R):5'- GCTGGTACATCCTCAGATGCAAAGAAAA -3'

Sequencing Primer
(F):5'- gccactgagccatttctatcac -3'
(R):5'- GAAAAGCAGACTTACATCGACG -3'

Posted On

2013-07-30