Incidental Mutation 'R8053:Fgd5'
ID619181
Institutional Source Beutler Lab
Gene Symbol Fgd5
Ensembl Gene ENSMUSG00000034037
Gene NameFYVE, RhoGEF and PH domain containing 5
SynonymsC330025N11Rik, ZFYVE23
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R8053 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location91978878-92076004 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 91989444 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 886 (S886N)
Ref Sequence ENSEMBL: ENSMUSP00000086748 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089334] [ENSMUST00000113466]
Predicted Effect probably benign
Transcript: ENSMUST00000089334
AA Change: S886N

PolyPhen 2 Score 0.342 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000086748
Gene: ENSMUSG00000034037
AA Change: S886N

DomainStartEndE-ValueType
low complexity region 7 16 N/A INTRINSIC
internal_repeat_1 126 169 2.6e-7 PROSPERO
internal_repeat_1 164 198 2.6e-7 PROSPERO
low complexity region 201 222 N/A INTRINSIC
low complexity region 254 269 N/A INTRINSIC
low complexity region 321 332 N/A INTRINSIC
low complexity region 426 442 N/A INTRINSIC
low complexity region 453 475 N/A INTRINSIC
low complexity region 652 663 N/A INTRINSIC
low complexity region 695 705 N/A INTRINSIC
low complexity region 727 736 N/A INTRINSIC
low complexity region 879 894 N/A INTRINSIC
low complexity region 914 928 N/A INTRINSIC
Pfam:RhoGEF 946 1134 2.2e-28 PFAM
PH 1165 1260 4.93e-13 SMART
FYVE 1285 1353 2.51e-16 SMART
low complexity region 1368 1390 N/A INTRINSIC
PH 1416 1514 2.77e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113466
AA Change: S728N

PolyPhen 2 Score 0.170 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000109093
Gene: ENSMUSG00000034037
AA Change: S728N

DomainStartEndE-ValueType
low complexity region 43 64 N/A INTRINSIC
low complexity region 96 111 N/A INTRINSIC
low complexity region 163 174 N/A INTRINSIC
low complexity region 268 284 N/A INTRINSIC
low complexity region 295 317 N/A INTRINSIC
low complexity region 494 505 N/A INTRINSIC
low complexity region 537 547 N/A INTRINSIC
low complexity region 569 578 N/A INTRINSIC
low complexity region 721 736 N/A INTRINSIC
low complexity region 756 770 N/A INTRINSIC
Pfam:RhoGEF 788 976 1.6e-27 PFAM
PH 1007 1102 4.93e-13 SMART
FYVE 1127 1195 2.51e-16 SMART
low complexity region 1210 1232 N/A INTRINSIC
PH 1258 1356 2.77e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous disruption of this gene leads to complete embryonic lethality during organogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A T 13: 63,190,531 K574* probably null Het
5730507C01Rik C T 12: 18,533,727 R263* probably null Het
Abca12 G A 1: 71,349,169 R181* probably null Het
Adar T C 3: 89,747,285 L908P probably damaging Het
Ankrd55 C T 13: 112,323,153 R94C probably damaging Het
Carf A T 1: 60,128,038 T177S probably benign Het
Ccdc162 C A 10: 41,644,581 G693V probably benign Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Chd4 G T 6: 125,128,816 E1799* probably null Het
Chrna3 T A 9: 55,015,390 N378I probably benign Het
Clec4a2 T C 6: 123,128,039 V96A probably benign Het
Cntnap5b T A 1: 100,390,677 L683Q probably damaging Het
Crisp4 T A 1: 18,124,274 Q208L probably benign Het
Crocc A G 4: 141,042,919 probably null Het
Cyp2ab1 T C 16: 20,314,268 E192G probably benign Het
Daglb A G 5: 143,503,269 K627R probably benign Het
Desi2 G A 1: 178,237,916 W16* probably null Het
Dtx3l T C 16: 35,938,952 probably benign Het
Elf2 A G 3: 51,308,130 V53A possibly damaging Het
Eomes A G 9: 118,480,553 D325G probably damaging Het
Etl4 A T 2: 20,661,963 L60F probably damaging Het
Exoc4 A G 6: 33,332,256 D271G probably benign Het
F5 A G 1: 164,192,769 I938V probably benign Het
Fam49b T C 15: 63,941,983 D155G probably damaging Het
Fdxr T A 11: 115,269,839 K290M probably benign Het
Gm11595 G A 11: 99,772,128 S242F unknown Het
Gm14322 A T 2: 177,769,631 Q78L probably damaging Het
Gm8267 A T 14: 44,724,850 S38T possibly damaging Het
Gm884 T A 11: 103,604,566 K2809I unknown Het
Gpr75 A T 11: 30,891,559 T155S probably benign Het
Hectd3 T C 4: 117,000,858 S628P possibly damaging Het
Hrh2 A G 13: 54,214,085 T27A probably benign Het
Kif16b G A 2: 142,853,714 R157C probably damaging Het
Krt16 T C 11: 100,246,787 Y364C probably damaging Het
Map2k5 T A 9: 63,343,425 N95I probably benign Het
Melk A G 4: 44,318,109 Y170C probably damaging Het
Mthfd1 T A 12: 76,280,508 D123E probably damaging Het
Muc2 A T 7: 141,698,332 Y827F probably benign Het
Myh15 T A 16: 49,142,939 M1081K possibly damaging Het
Nbeal1 A G 1: 60,279,795 T1998A probably damaging Het
Neb T A 2: 52,286,017 T1477S possibly damaging Het
Nox4 C A 7: 87,370,047 P416Q probably damaging Het
Olfr1000 T C 2: 85,608,890 T7A probably damaging Het
Olfr1230 A T 2: 89,297,196 F25I possibly damaging Het
Olfr1328 A G 4: 118,934,111 S246P probably damaging Het
Olfr137 A T 17: 38,305,210 F84I probably benign Het
Olfr391-ps T C 11: 73,798,996 T254A probably benign Het
Pcdhga4 A G 18: 37,686,255 K286E probably benign Het
Pde10a A G 17: 8,974,772 T679A probably benign Het
Phc2 C T 4: 128,709,640 Q188* probably null Het
Pramef8 C A 4: 143,417,638 Q185K probably benign Het
Prdm15 A G 16: 97,835,607 M170T probably benign Het
Rab20 G T 8: 11,454,443 Q86K probably damaging Het
Rev1 T C 1: 38,063,141 I714V possibly damaging Het
Rexo2 A G 9: 48,475,118 probably null Het
Rnf213 A G 11: 119,402,647 K75E Het
Sdk2 C T 11: 113,854,351 R706Q probably damaging Het
Sema3c C T 5: 17,655,022 T95I probably benign Het
Sh3rf2 T A 18: 42,153,022 S527T probably damaging Het
Sis A T 3: 72,949,568 Y434* probably null Het
Slc16a6 G A 11: 109,458,569 T222I probably damaging Het
Smad6 A G 9: 64,020,507 L173P probably damaging Het
Sugct T A 13: 17,301,969 N310I probably damaging Het
Syne1 T A 10: 5,052,658 K259* probably null Het
Taar6 A G 10: 23,985,246 V134A possibly damaging Het
Tmem199 A G 11: 78,507,786 I184T possibly damaging Het
Tnrc18 G T 5: 142,750,630 D1530E unknown Het
Tnxb G A 17: 34,704,179 V2579M probably damaging Het
Vangl2 A G 1: 172,004,736 F518L probably damaging Het
Vmn2r40 T C 7: 8,908,246 T683A Het
Wapl C T 14: 34,692,321 T380I probably damaging Het
Zfp874b A T 13: 67,474,098 H360Q probably damaging Het
Other mutations in Fgd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Fgd5 APN 6 91988459 missense possibly damaging 0.63
IGL01354:Fgd5 APN 6 92061843 nonsense probably null
IGL01597:Fgd5 APN 6 91987929 missense probably damaging 1.00
IGL01648:Fgd5 APN 6 91989359 nonsense probably null
IGL01781:Fgd5 APN 6 91988717 missense possibly damaging 0.88
IGL01977:Fgd5 APN 6 92024562 missense probably benign 0.20
IGL02053:Fgd5 APN 6 92053244 missense probably benign 0.03
IGL02206:Fgd5 APN 6 91987258 utr 5 prime probably benign
IGL02825:Fgd5 APN 6 92038087 splice site probably null
IGL02838:Fgd5 APN 6 91987674 missense probably benign
IGL03126:Fgd5 APN 6 92065164 missense probably damaging 1.00
IGL03369:Fgd5 APN 6 91988415 missense probably damaging 1.00
hygeia UTSW 6 91989300 missense probably damaging 1.00
Imploded UTSW 6 92049931 splice site probably null
R0029:Fgd5 UTSW 6 92067558 missense probably benign 0.04
R0109:Fgd5 UTSW 6 91988235 missense possibly damaging 0.74
R0109:Fgd5 UTSW 6 91988235 missense possibly damaging 0.74
R0212:Fgd5 UTSW 6 91988208 missense probably damaging 1.00
R1148:Fgd5 UTSW 6 91987631 missense probably benign
R1148:Fgd5 UTSW 6 91987631 missense probably benign
R1159:Fgd5 UTSW 6 91988502 missense probably benign 0.00
R1199:Fgd5 UTSW 6 91986978 missense possibly damaging 0.87
R1493:Fgd5 UTSW 6 91987631 missense probably benign
R1602:Fgd5 UTSW 6 92066184 missense possibly damaging 0.95
R1953:Fgd5 UTSW 6 92024630 missense probably benign 0.31
R2280:Fgd5 UTSW 6 91988945 missense possibly damaging 0.86
R2437:Fgd5 UTSW 6 92062869 nonsense probably null
R2883:Fgd5 UTSW 6 91987109 splice site probably null
R4133:Fgd5 UTSW 6 92069437 missense probably damaging 1.00
R4454:Fgd5 UTSW 6 91989186 missense probably damaging 1.00
R4491:Fgd5 UTSW 6 91989299 missense possibly damaging 0.90
R4606:Fgd5 UTSW 6 91988209 missense possibly damaging 0.67
R4981:Fgd5 UTSW 6 91989300 missense probably damaging 1.00
R5162:Fgd5 UTSW 6 92074234 missense probably damaging 1.00
R5525:Fgd5 UTSW 6 92066247 missense probably damaging 1.00
R5570:Fgd5 UTSW 6 91988687 missense probably damaging 1.00
R5936:Fgd5 UTSW 6 91987911 missense probably damaging 0.98
R6012:Fgd5 UTSW 6 91989341 missense possibly damaging 0.95
R6723:Fgd5 UTSW 6 91988030 missense probably benign
R6764:Fgd5 UTSW 6 91989421 missense probably damaging 0.96
R7187:Fgd5 UTSW 6 91988291 missense possibly damaging 0.54
R7383:Fgd5 UTSW 6 91987118 missense probably benign 0.01
R7418:Fgd5 UTSW 6 92024538 missense probably benign 0.11
R7662:Fgd5 UTSW 6 92049931 splice site probably null
R7788:Fgd5 UTSW 6 91988459 missense possibly damaging 0.63
R7882:Fgd5 UTSW 6 92068478 missense probably damaging 1.00
R7895:Fgd5 UTSW 6 91987281 missense probably benign 0.03
R8041:Fgd5 UTSW 6 92061856 missense probably damaging 0.98
R8176:Fgd5 UTSW 6 91987984 missense probably benign 0.13
R8243:Fgd5 UTSW 6 91989023 missense possibly damaging 0.93
R8318:Fgd5 UTSW 6 91987496 missense probably benign 0.17
R8772:Fgd5 UTSW 6 92050419 missense probably damaging 0.99
R8804:Fgd5 UTSW 6 91987526 missense probably benign
X0064:Fgd5 UTSW 6 92050040 missense probably benign 0.02
Z1176:Fgd5 UTSW 6 91988889 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGCCATGAACTCAGACTATG -3'
(R):5'- ACATGCATGAGAACTGTCCC -3'

Sequencing Primer
(F):5'- TCAGACTATGAGAATATCCAGATCC -3'
(R):5'- GCATGAGAACTGTCCCATTTATACTG -3'
Posted On2020-01-23