Incidental Mutation 'R8053:Map2k5'
ID619190
Institutional Source Beutler Lab
Gene Symbol Map2k5
Ensembl Gene ENSMUSG00000058444
Gene Namemitogen-activated protein kinase kinase 5
SynonymsMEK5
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8053 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location63163768-63377902 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 63343425 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 95 (N95I)
Ref Sequence ENSEMBL: ENSMUSP00000034920 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034920]
PDB Structure Solution structure of the PB1 domain of mouse mitogen activated protein kinase kinase 5 (MAP2K5) [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000034920
AA Change: N95I

PolyPhen 2 Score 0.156 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000034920
Gene: ENSMUSG00000058444
AA Change: N95I

DomainStartEndE-ValueType
PB1 18 97 7.59e-12 SMART
S_TKc 166 419 7.75e-71 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a dual specificity protein kinase that belongs to the MAP kinase kinase family. This kinase specifically interacts with and activates MAPK7/ERK5. This kinase itself can be phosphorylated and activated by MAP3K3/MEKK3, as well as by atypical protein kinase C isoforms (aPKCs). The signal cascade mediated by this kinase is involved in growth factor stimulated cell proliferation and muscle cell differentiation. Three alternatively spliced transcript variants of this gene encoding distinct isoforms have been described. [provided by RefSeq, May 2011]
PHENOTYPE: Homozygous mutants die at E10.5 and exhibit abnormal cardiac development and a decrease in proliferation and an increase in apoptosis in the heart, head, and dorsal regions of the embryo. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A T 13: 63,190,531 K574* probably null Het
5730507C01Rik C T 12: 18,533,727 R263* probably null Het
Abca12 G A 1: 71,349,169 R181* probably null Het
Adar T C 3: 89,747,285 L908P probably damaging Het
Ankrd55 C T 13: 112,323,153 R94C probably damaging Het
Carf A T 1: 60,128,038 T177S probably benign Het
Ccdc162 C A 10: 41,644,581 G693V probably benign Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Chd4 G T 6: 125,128,816 E1799* probably null Het
Chrna3 T A 9: 55,015,390 N378I probably benign Het
Clec4a2 T C 6: 123,128,039 V96A probably benign Het
Cntnap5b T A 1: 100,390,677 L683Q probably damaging Het
Crisp4 T A 1: 18,124,274 Q208L probably benign Het
Crocc A G 4: 141,042,919 probably null Het
Cyp2ab1 T C 16: 20,314,268 E192G probably benign Het
Daglb A G 5: 143,503,269 K627R probably benign Het
Desi2 G A 1: 178,237,916 W16* probably null Het
Dtx3l T C 16: 35,938,952 probably benign Het
Elf2 A G 3: 51,308,130 V53A possibly damaging Het
Eomes A G 9: 118,480,553 D325G probably damaging Het
Etl4 A T 2: 20,661,963 L60F probably damaging Het
Exoc4 A G 6: 33,332,256 D271G probably benign Het
F5 A G 1: 164,192,769 I938V probably benign Het
Fam49b T C 15: 63,941,983 D155G probably damaging Het
Fdxr T A 11: 115,269,839 K290M probably benign Het
Fgd5 G A 6: 91,989,444 S886N probably benign Het
Gm11595 G A 11: 99,772,128 S242F unknown Het
Gm14322 A T 2: 177,769,631 Q78L probably damaging Het
Gm8267 A T 14: 44,724,850 S38T possibly damaging Het
Gm884 T A 11: 103,604,566 K2809I unknown Het
Gpr75 A T 11: 30,891,559 T155S probably benign Het
Hectd3 T C 4: 117,000,858 S628P possibly damaging Het
Hrh2 A G 13: 54,214,085 T27A probably benign Het
Kif16b G A 2: 142,853,714 R157C probably damaging Het
Krt16 T C 11: 100,246,787 Y364C probably damaging Het
Melk A G 4: 44,318,109 Y170C probably damaging Het
Mthfd1 T A 12: 76,280,508 D123E probably damaging Het
Muc2 A T 7: 141,698,332 Y827F probably benign Het
Myh15 T A 16: 49,142,939 M1081K possibly damaging Het
Nbeal1 A G 1: 60,279,795 T1998A probably damaging Het
Neb T A 2: 52,286,017 T1477S possibly damaging Het
Nox4 C A 7: 87,370,047 P416Q probably damaging Het
Olfr1000 T C 2: 85,608,890 T7A probably damaging Het
Olfr1230 A T 2: 89,297,196 F25I possibly damaging Het
Olfr1328 A G 4: 118,934,111 S246P probably damaging Het
Olfr137 A T 17: 38,305,210 F84I probably benign Het
Olfr391-ps T C 11: 73,798,996 T254A probably benign Het
Pcdhga4 A G 18: 37,686,255 K286E probably benign Het
Pde10a A G 17: 8,974,772 T679A probably benign Het
Phc2 C T 4: 128,709,640 Q188* probably null Het
Pramef8 C A 4: 143,417,638 Q185K probably benign Het
Prdm15 A G 16: 97,835,607 M170T probably benign Het
Rab20 G T 8: 11,454,443 Q86K probably damaging Het
Rev1 T C 1: 38,063,141 I714V possibly damaging Het
Rexo2 A G 9: 48,475,118 probably null Het
Rnf213 A G 11: 119,402,647 K75E Het
Sdk2 C T 11: 113,854,351 R706Q probably damaging Het
Sema3c C T 5: 17,655,022 T95I probably benign Het
Sh3rf2 T A 18: 42,153,022 S527T probably damaging Het
Sis A T 3: 72,949,568 Y434* probably null Het
Slc16a6 G A 11: 109,458,569 T222I probably damaging Het
Smad6 A G 9: 64,020,507 L173P probably damaging Het
Sugct T A 13: 17,301,969 N310I probably damaging Het
Syne1 T A 10: 5,052,658 K259* probably null Het
Taar6 A G 10: 23,985,246 V134A possibly damaging Het
Tmem199 A G 11: 78,507,786 I184T possibly damaging Het
Tnrc18 G T 5: 142,750,630 D1530E unknown Het
Tnxb G A 17: 34,704,179 V2579M probably damaging Het
Vangl2 A G 1: 172,004,736 F518L probably damaging Het
Vmn2r40 T C 7: 8,908,246 T683A Het
Wapl C T 14: 34,692,321 T380I probably damaging Het
Zfp874b A T 13: 67,474,098 H360Q probably damaging Het
Other mutations in Map2k5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Map2k5 APN 9 63281077 splice site probably benign
IGL01412:Map2k5 APN 9 63293706 missense probably damaging 1.00
IGL01766:Map2k5 APN 9 63377227 missense probably benign
IGL02246:Map2k5 APN 9 63377129 missense probably benign 0.10
IGL02270:Map2k5 APN 9 63322197 splice site probably null
IGL02793:Map2k5 APN 9 63257039 missense probably benign 0.32
IGL03236:Map2k5 APN 9 63286392 splice site probably benign
R0007:Map2k5 UTSW 9 63293724 missense probably damaging 1.00
R0217:Map2k5 UTSW 9 63256975 critical splice donor site probably null
R0315:Map2k5 UTSW 9 63303151 missense probably damaging 1.00
R0801:Map2k5 UTSW 9 63357979 splice site probably benign
R1122:Map2k5 UTSW 9 63263163 missense probably damaging 1.00
R1822:Map2k5 UTSW 9 63235303 missense possibly damaging 0.79
R4308:Map2k5 UTSW 9 63235304 missense probably benign 0.02
R4421:Map2k5 UTSW 9 63164130 missense probably damaging 0.96
R4720:Map2k5 UTSW 9 63293719 missense probably damaging 1.00
R4869:Map2k5 UTSW 9 63322243 nonsense probably null
R5059:Map2k5 UTSW 9 63257014 missense probably benign 0.41
R5138:Map2k5 UTSW 9 63263158 missense probably damaging 0.99
R6005:Map2k5 UTSW 9 63281019 missense probably damaging 1.00
R6258:Map2k5 UTSW 9 63217365 missense probably benign 0.16
R6261:Map2k5 UTSW 9 63338098 missense probably benign 0.00
R6498:Map2k5 UTSW 9 63286401 missense possibly damaging 0.74
R6808:Map2k5 UTSW 9 63322246 missense probably benign 0.00
R7228:Map2k5 UTSW 9 63358022 missense probably damaging 1.00
R7819:Map2k5 UTSW 9 63358018 missense probably damaging 0.99
R8017:Map2k5 UTSW 9 63339121 missense probably damaging 0.98
R8247:Map2k5 UTSW 9 63371737 missense probably damaging 1.00
R8309:Map2k5 UTSW 9 63339079 critical splice donor site probably null
R8341:Map2k5 UTSW 9 63339098 missense probably damaging 1.00
Z1176:Map2k5 UTSW 9 63358038 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACTATAATGTAGCTTGCAATCCCC -3'
(R):5'- GTGGTATGGACGATAACCCC -3'

Sequencing Primer
(F):5'- GTAGCTTGCAATCCCCCATGATAATG -3'
(R):5'- TGGTATGGACGATAACCCCCTACTAG -3'
Posted On2020-01-23