Incidental Mutation 'R8053:Eomes'
ID619192
Institutional Source Beutler Lab
Gene Symbol Eomes
Ensembl Gene ENSMUSG00000032446
Gene Nameeomesodermin
SynonymsTbr2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8053 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location118478212-118486132 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 118480553 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 325 (D325G)
Ref Sequence ENSEMBL: ENSMUSP00000035020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035020] [ENSMUST00000111763] [ENSMUST00000150633]
Predicted Effect probably damaging
Transcript: ENSMUST00000035020
AA Change: D325G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000035020
Gene: ENSMUSG00000032446
AA Change: D325G

DomainStartEndE-ValueType
low complexity region 73 96 N/A INTRINSIC
low complexity region 127 134 N/A INTRINSIC
low complexity region 211 240 N/A INTRINSIC
low complexity region 246 266 N/A INTRINSIC
TBOX 268 463 7.3e-120 SMART
Pfam:T-box_assoc 484 705 1.6e-101 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111763
AA Change: D325G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107393
Gene: ENSMUSG00000032446
AA Change: D325G

DomainStartEndE-ValueType
low complexity region 73 96 N/A INTRINSIC
low complexity region 127 134 N/A INTRINSIC
low complexity region 211 240 N/A INTRINSIC
low complexity region 246 266 N/A INTRINSIC
TBOX 268 463 5.53e-120 SMART
Blast:TBOX 485 511 6e-8 BLAST
low complexity region 648 659 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000150633
AA Change: D258G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000118079
Gene: ENSMUSG00000032446
AA Change: D258G

DomainStartEndE-ValueType
low complexity region 6 29 N/A INTRINSIC
low complexity region 60 67 N/A INTRINSIC
low complexity region 144 173 N/A INTRINSIC
low complexity region 179 199 N/A INTRINSIC
TBOX 201 395 8.01e-117 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the TBR1 (T-box brain protein 1) sub-family of T-box genes that share the common DNA-binding T-box domain. The encoded protein is a transcription factor which is crucial for embryonic development of mesoderm and the central nervous system in vertebrates. The protein may also be necessary for the differentiation of effector CD8+ T cells which are involved in defense against viral infections. A similar gene disrupted in mice is shown to be essential during trophoblast development and gastrulation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygous null mice display embryonic lethality, fail to implant, and lack trophoectoderm outgrowth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A T 13: 63,190,531 K574* probably null Het
5730507C01Rik C T 12: 18,533,727 R263* probably null Het
Abca12 G A 1: 71,349,169 R181* probably null Het
Adar T C 3: 89,747,285 L908P probably damaging Het
Ankrd55 C T 13: 112,323,153 R94C probably damaging Het
Carf A T 1: 60,128,038 T177S probably benign Het
Ccdc162 C A 10: 41,644,581 G693V probably benign Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Chd4 G T 6: 125,128,816 E1799* probably null Het
Chrna3 T A 9: 55,015,390 N378I probably benign Het
Clec4a2 T C 6: 123,128,039 V96A probably benign Het
Cntnap5b T A 1: 100,390,677 L683Q probably damaging Het
Crisp4 T A 1: 18,124,274 Q208L probably benign Het
Crocc A G 4: 141,042,919 probably null Het
Cyp2ab1 T C 16: 20,314,268 E192G probably benign Het
Daglb A G 5: 143,503,269 K627R probably benign Het
Desi2 G A 1: 178,237,916 W16* probably null Het
Dtx3l T C 16: 35,938,952 probably benign Het
Elf2 A G 3: 51,308,130 V53A possibly damaging Het
Etl4 A T 2: 20,661,963 L60F probably damaging Het
Exoc4 A G 6: 33,332,256 D271G probably benign Het
F5 A G 1: 164,192,769 I938V probably benign Het
Fam49b T C 15: 63,941,983 D155G probably damaging Het
Fdxr T A 11: 115,269,839 K290M probably benign Het
Fgd5 G A 6: 91,989,444 S886N probably benign Het
Gm11595 G A 11: 99,772,128 S242F unknown Het
Gm14322 A T 2: 177,769,631 Q78L probably damaging Het
Gm8267 A T 14: 44,724,850 S38T possibly damaging Het
Gm884 T A 11: 103,604,566 K2809I unknown Het
Gpr75 A T 11: 30,891,559 T155S probably benign Het
Hectd3 T C 4: 117,000,858 S628P possibly damaging Het
Hrh2 A G 13: 54,214,085 T27A probably benign Het
Kif16b G A 2: 142,853,714 R157C probably damaging Het
Krt16 T C 11: 100,246,787 Y364C probably damaging Het
Map2k5 T A 9: 63,343,425 N95I probably benign Het
Melk A G 4: 44,318,109 Y170C probably damaging Het
Mthfd1 T A 12: 76,280,508 D123E probably damaging Het
Muc2 A T 7: 141,698,332 Y827F probably benign Het
Myh15 T A 16: 49,142,939 M1081K possibly damaging Het
Nbeal1 A G 1: 60,279,795 T1998A probably damaging Het
Neb T A 2: 52,286,017 T1477S possibly damaging Het
Nox4 C A 7: 87,370,047 P416Q probably damaging Het
Olfr1000 T C 2: 85,608,890 T7A probably damaging Het
Olfr1230 A T 2: 89,297,196 F25I possibly damaging Het
Olfr1328 A G 4: 118,934,111 S246P probably damaging Het
Olfr137 A T 17: 38,305,210 F84I probably benign Het
Olfr391-ps T C 11: 73,798,996 T254A probably benign Het
Pcdhga4 A G 18: 37,686,255 K286E probably benign Het
Pde10a A G 17: 8,974,772 T679A probably benign Het
Phc2 C T 4: 128,709,640 Q188* probably null Het
Pramef8 C A 4: 143,417,638 Q185K probably benign Het
Prdm15 A G 16: 97,835,607 M170T probably benign Het
Rab20 G T 8: 11,454,443 Q86K probably damaging Het
Rev1 T C 1: 38,063,141 I714V possibly damaging Het
Rexo2 A G 9: 48,475,118 probably null Het
Rnf213 A G 11: 119,402,647 K75E Het
Sdk2 C T 11: 113,854,351 R706Q probably damaging Het
Sema3c C T 5: 17,655,022 T95I probably benign Het
Sh3rf2 T A 18: 42,153,022 S527T probably damaging Het
Sis A T 3: 72,949,568 Y434* probably null Het
Slc16a6 G A 11: 109,458,569 T222I probably damaging Het
Smad6 A G 9: 64,020,507 L173P probably damaging Het
Sugct T A 13: 17,301,969 N310I probably damaging Het
Syne1 T A 10: 5,052,658 K259* probably null Het
Taar6 A G 10: 23,985,246 V134A possibly damaging Het
Tmem199 A G 11: 78,507,786 I184T possibly damaging Het
Tnrc18 G T 5: 142,750,630 D1530E unknown Het
Tnxb G A 17: 34,704,179 V2579M probably damaging Het
Vangl2 A G 1: 172,004,736 F518L probably damaging Het
Vmn2r40 T C 7: 8,908,246 T683A Het
Wapl C T 14: 34,692,321 T380I probably damaging Het
Zfp874b A T 13: 67,474,098 H360Q probably damaging Het
Other mutations in Eomes
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01112:Eomes APN 9 118482266 missense probably damaging 1.00
IGL01322:Eomes APN 9 118484830 missense probably benign 0.14
IGL01532:Eomes APN 9 118482249 missense probably damaging 1.00
R0088:Eomes UTSW 9 118478673 missense probably damaging 0.99
R0305:Eomes UTSW 9 118484757 missense probably benign 0.11
R0894:Eomes UTSW 9 118482300 splice site probably null
R1110:Eomes UTSW 9 118484599 missense probably benign 0.29
R1326:Eomes UTSW 9 118484497 nonsense probably null
R1942:Eomes UTSW 9 118484648 missense probably benign 0.01
R2108:Eomes UTSW 9 118478852 missense probably benign 0.09
R2237:Eomes UTSW 9 118482291 missense probably damaging 1.00
R2238:Eomes UTSW 9 118482291 missense probably damaging 1.00
R2239:Eomes UTSW 9 118482291 missense probably damaging 1.00
R3915:Eomes UTSW 9 118481273 missense probably benign 0.01
R4158:Eomes UTSW 9 118478963 missense probably benign
R5274:Eomes UTSW 9 118480529 missense probably damaging 1.00
R6894:Eomes UTSW 9 118481285 missense probably damaging 1.00
R7055:Eomes UTSW 9 118480499 missense possibly damaging 0.57
R7115:Eomes UTSW 9 118484489 missense probably benign 0.00
X0021:Eomes UTSW 9 118482258 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAGTTTCAGGCCGTAGTAGC -3'
(R):5'- TTTCTCCCCAGCAGCAGAAG -3'

Sequencing Primer
(F):5'- GCCGTAGTAGCCATTTTTGTTTG -3'
(R):5'- GCACATGCTAACATCCCCATG -3'
Posted On2020-01-23