Incidental Mutation 'R8053:Taar6'
ID619194
Institutional Source Beutler Lab
Gene Symbol Taar6
Ensembl Gene ENSMUSG00000045111
Gene Nametrace amine-associated receptor 6
SynonymsLOC215855
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.229) question?
Stock #R8053 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location23984609-23985646 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23985246 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 134 (V134A)
Ref Sequence ENSEMBL: ENSMUSP00000097603 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057080]
Predicted Effect possibly damaging
Transcript: ENSMUST00000057080
AA Change: V134A

PolyPhen 2 Score 0.594 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000097603
Gene: ENSMUSG00000045111
AA Change: V134A

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 43 326 5.5e-13 PFAM
Pfam:7tm_1 49 311 5.9e-58 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a seven-transmembrane G-protein-coupled receptor that likely functions as a receptor for endogenous trace amines. Mutations in this gene may be associated with schizophrenia.[provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A T 13: 63,190,531 K574* probably null Het
5730507C01Rik C T 12: 18,533,727 R263* probably null Het
Abca12 G A 1: 71,349,169 R181* probably null Het
Adar T C 3: 89,747,285 L908P probably damaging Het
Ankrd55 C T 13: 112,323,153 R94C probably damaging Het
Carf A T 1: 60,128,038 T177S probably benign Het
Ccdc162 C A 10: 41,644,581 G693V probably benign Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Chd4 G T 6: 125,128,816 E1799* probably null Het
Chrna3 T A 9: 55,015,390 N378I probably benign Het
Clec4a2 T C 6: 123,128,039 V96A probably benign Het
Cntnap5b T A 1: 100,390,677 L683Q probably damaging Het
Crisp4 T A 1: 18,124,274 Q208L probably benign Het
Crocc A G 4: 141,042,919 probably null Het
Cyp2ab1 T C 16: 20,314,268 E192G probably benign Het
Daglb A G 5: 143,503,269 K627R probably benign Het
Desi2 G A 1: 178,237,916 W16* probably null Het
Dtx3l T C 16: 35,938,952 probably benign Het
Elf2 A G 3: 51,308,130 V53A possibly damaging Het
Eomes A G 9: 118,480,553 D325G probably damaging Het
Etl4 A T 2: 20,661,963 L60F probably damaging Het
Exoc4 A G 6: 33,332,256 D271G probably benign Het
F5 A G 1: 164,192,769 I938V probably benign Het
Fam49b T C 15: 63,941,983 D155G probably damaging Het
Fdxr T A 11: 115,269,839 K290M probably benign Het
Fgd5 G A 6: 91,989,444 S886N probably benign Het
Gm11595 G A 11: 99,772,128 S242F unknown Het
Gm14322 A T 2: 177,769,631 Q78L probably damaging Het
Gm8267 A T 14: 44,724,850 S38T possibly damaging Het
Gm884 T A 11: 103,604,566 K2809I unknown Het
Gpr75 A T 11: 30,891,559 T155S probably benign Het
Hectd3 T C 4: 117,000,858 S628P possibly damaging Het
Hrh2 A G 13: 54,214,085 T27A probably benign Het
Kif16b G A 2: 142,853,714 R157C probably damaging Het
Krt16 T C 11: 100,246,787 Y364C probably damaging Het
Map2k5 T A 9: 63,343,425 N95I probably benign Het
Melk A G 4: 44,318,109 Y170C probably damaging Het
Mthfd1 T A 12: 76,280,508 D123E probably damaging Het
Muc2 A T 7: 141,698,332 Y827F probably benign Het
Myh15 T A 16: 49,142,939 M1081K possibly damaging Het
Nbeal1 A G 1: 60,279,795 T1998A probably damaging Het
Neb T A 2: 52,286,017 T1477S possibly damaging Het
Nox4 C A 7: 87,370,047 P416Q probably damaging Het
Olfr1000 T C 2: 85,608,890 T7A probably damaging Het
Olfr1230 A T 2: 89,297,196 F25I possibly damaging Het
Olfr1328 A G 4: 118,934,111 S246P probably damaging Het
Olfr137 A T 17: 38,305,210 F84I probably benign Het
Olfr391-ps T C 11: 73,798,996 T254A probably benign Het
Pcdhga4 A G 18: 37,686,255 K286E probably benign Het
Pde10a A G 17: 8,974,772 T679A probably benign Het
Phc2 C T 4: 128,709,640 Q188* probably null Het
Pramef8 C A 4: 143,417,638 Q185K probably benign Het
Prdm15 A G 16: 97,835,607 M170T probably benign Het
Rab20 G T 8: 11,454,443 Q86K probably damaging Het
Rev1 T C 1: 38,063,141 I714V possibly damaging Het
Rexo2 A G 9: 48,475,118 probably null Het
Rnf213 A G 11: 119,402,647 K75E Het
Sdk2 C T 11: 113,854,351 R706Q probably damaging Het
Sema3c C T 5: 17,655,022 T95I probably benign Het
Sh3rf2 T A 18: 42,153,022 S527T probably damaging Het
Sis A T 3: 72,949,568 Y434* probably null Het
Slc16a6 G A 11: 109,458,569 T222I probably damaging Het
Smad6 A G 9: 64,020,507 L173P probably damaging Het
Sugct T A 13: 17,301,969 N310I probably damaging Het
Syne1 T A 10: 5,052,658 K259* probably null Het
Tmem199 A G 11: 78,507,786 I184T possibly damaging Het
Tnrc18 G T 5: 142,750,630 D1530E unknown Het
Tnxb G A 17: 34,704,179 V2579M probably damaging Het
Vangl2 A G 1: 172,004,736 F518L probably damaging Het
Vmn2r40 T C 7: 8,908,246 T683A Het
Wapl C T 14: 34,692,321 T380I probably damaging Het
Zfp874b A T 13: 67,474,098 H360Q probably damaging Het
Other mutations in Taar6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00648:Taar6 APN 10 23985508 missense probably benign 0.15
IGL00918:Taar6 APN 10 23985582 missense probably damaging 1.00
IGL01060:Taar6 APN 10 23985072 missense probably benign
IGL02608:Taar6 APN 10 23985183 missense probably benign 0.01
R0042:Taar6 UTSW 10 23985123 missense probably benign 0.36
R0042:Taar6 UTSW 10 23985123 missense probably benign 0.36
R0360:Taar6 UTSW 10 23985148 missense probably benign 0.01
R0364:Taar6 UTSW 10 23985148 missense probably benign 0.01
R0746:Taar6 UTSW 10 23985360 missense probably benign 0.43
R1637:Taar6 UTSW 10 23985181 missense probably benign 0.12
R4893:Taar6 UTSW 10 23985400 missense probably benign
R4944:Taar6 UTSW 10 23984715 missense probably damaging 1.00
R4951:Taar6 UTSW 10 23985208 missense probably benign 0.09
R5173:Taar6 UTSW 10 23985352 missense probably damaging 1.00
R5181:Taar6 UTSW 10 23984785 missense possibly damaging 0.76
R5919:Taar6 UTSW 10 23985270 missense probably damaging 1.00
R5988:Taar6 UTSW 10 23985256 missense probably damaging 0.98
R6327:Taar6 UTSW 10 23985279 missense probably damaging 1.00
R6493:Taar6 UTSW 10 23985123 missense probably benign 0.36
R7595:Taar6 UTSW 10 23985070 missense probably benign
R7802:Taar6 UTSW 10 23985253 missense probably benign 0.02
R8506:Taar6 UTSW 10 23985631 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGATTCACAACTACCTGACAGC -3'
(R):5'- TTTCAAGCAGCTGCACTCTC -3'

Sequencing Primer
(F):5'- AGCCCCCTACGCAGTTGAG -3'
(R):5'- ATCCTTGGCCTGTGCTGAC -3'
Posted On2020-01-23