Incidental Mutation 'R0662:Kat6b'
ID61921
Institutional Source Beutler Lab
Gene Symbol Kat6b
Ensembl Gene ENSMUSG00000021767
Gene NameK(lysine) acetyltransferase 6B
SynonymsMyst4, monocytic leukemia, querkopf, B130044K16Rik, Morf, qkf
MMRRC Submission 038847-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.941) question?
Stock #R0662 (G1)
Quality Score116
Status Not validated
Chromosome14
Chromosomal Location21481434-21672478 bp(+) (GRCm38)
Type of Mutationsmall deletion (1 aa in frame mutation)
DNA Base Change (assembly) AGAGGAGGAGGAGGAGGAGGA to AGAGGAGGAGGAGGAGGA at 21662349 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000138421 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069648] [ENSMUST00000112458] [ENSMUST00000182405] [ENSMUST00000182855] [ENSMUST00000182964]
Predicted Effect probably benign
Transcript: ENSMUST00000069648
SMART Domains Protein: ENSMUSP00000066693
Gene: ENSMUSG00000021767

DomainStartEndE-ValueType
H15 94 171 1.7e-12 SMART
low complexity region 189 203 N/A INTRINSIC
PHD 216 271 6.6e-5 SMART
PHD 272 319 5.56e-12 SMART
low complexity region 386 398 N/A INTRINSIC
low complexity region 411 425 N/A INTRINSIC
Blast:PHD 483 573 3e-51 BLAST
Pfam:MOZ_SAS 594 772 4.5e-85 PFAM
coiled coil region 811 845 N/A INTRINSIC
coiled coil region 875 913 N/A INTRINSIC
low complexity region 926 943 N/A INTRINSIC
low complexity region 946 959 N/A INTRINSIC
low complexity region 1153 1175 N/A INTRINSIC
low complexity region 1207 1237 N/A INTRINSIC
low complexity region 1391 1410 N/A INTRINSIC
low complexity region 1450 1464 N/A INTRINSIC
low complexity region 1490 1517 N/A INTRINSIC
low complexity region 1676 1695 N/A INTRINSIC
low complexity region 1811 1832 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112458
SMART Domains Protein: ENSMUSP00000108077
Gene: ENSMUSG00000021767

DomainStartEndE-ValueType
H15 94 159 3.4e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182405
SMART Domains Protein: ENSMUSP00000138377
Gene: ENSMUSG00000021767

DomainStartEndE-ValueType
H15 94 171 1.7e-12 SMART
low complexity region 189 203 N/A INTRINSIC
PHD 216 271 6.6e-5 SMART
PHD 272 319 5.56e-12 SMART
Pfam:MOZ_SAS 482 669 1.3e-89 PFAM
coiled coil region 702 736 N/A INTRINSIC
coiled coil region 766 804 N/A INTRINSIC
low complexity region 817 834 N/A INTRINSIC
low complexity region 837 850 N/A INTRINSIC
low complexity region 1044 1066 N/A INTRINSIC
low complexity region 1098 1128 N/A INTRINSIC
low complexity region 1282 1301 N/A INTRINSIC
low complexity region 1341 1355 N/A INTRINSIC
low complexity region 1381 1408 N/A INTRINSIC
low complexity region 1567 1586 N/A INTRINSIC
low complexity region 1702 1723 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182855
SMART Domains Protein: ENSMUSP00000138511
Gene: ENSMUSG00000021767

DomainStartEndE-ValueType
H15 94 171 1.7e-12 SMART
low complexity region 189 203 N/A INTRINSIC
PHD 216 271 6.6e-5 SMART
PHD 272 319 5.56e-12 SMART
Pfam:MOZ_SAS 482 669 1.3e-89 PFAM
coiled coil region 702 736 N/A INTRINSIC
coiled coil region 766 804 N/A INTRINSIC
low complexity region 817 834 N/A INTRINSIC
low complexity region 837 850 N/A INTRINSIC
low complexity region 1044 1066 N/A INTRINSIC
low complexity region 1098 1128 N/A INTRINSIC
low complexity region 1282 1301 N/A INTRINSIC
low complexity region 1341 1355 N/A INTRINSIC
low complexity region 1381 1408 N/A INTRINSIC
low complexity region 1567 1586 N/A INTRINSIC
low complexity region 1702 1723 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182964
SMART Domains Protein: ENSMUSP00000138421
Gene: ENSMUSG00000021767

DomainStartEndE-ValueType
H15 94 171 1.7e-12 SMART
low complexity region 189 203 N/A INTRINSIC
PHD 216 271 6.6e-5 SMART
PHD 272 319 5.56e-12 SMART
low complexity region 386 398 N/A INTRINSIC
low complexity region 411 425 N/A INTRINSIC
Blast:PHD 483 573 3e-51 BLAST
Pfam:MOZ_SAS 591 778 1.4e-89 PFAM
coiled coil region 811 845 N/A INTRINSIC
coiled coil region 875 913 N/A INTRINSIC
low complexity region 926 943 N/A INTRINSIC
low complexity region 946 959 N/A INTRINSIC
low complexity region 1153 1175 N/A INTRINSIC
low complexity region 1207 1237 N/A INTRINSIC
low complexity region 1391 1410 N/A INTRINSIC
low complexity region 1450 1464 N/A INTRINSIC
low complexity region 1490 1517 N/A INTRINSIC
low complexity region 1676 1695 N/A INTRINSIC
low complexity region 1811 1832 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.6%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Reduced expression of this gene results in developmental defects of the skeleton and brain, particularly the cerebral cortex. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf T C 19: 31,920,938 S241P probably benign Het
Ankrd53 G T 6: 83,763,643 V83L probably damaging Het
Armcx2 G A X: 134,805,636 T416I possibly damaging Het
C4b G A 17: 34,730,888 R1441C probably damaging Het
Cacng3 T C 7: 122,768,359 I154T probably damaging Het
Cand2 A G 6: 115,787,210 D315G probably benign Het
Celsr2 A T 3: 108,398,520 S2089R probably damaging Het
Chd9 A C 8: 90,977,676 K247Q probably damaging Het
Chil1 A C 1: 134,188,573 S263R probably damaging Het
Clec12b A C 6: 129,376,237 C262W probably damaging Het
Cpsf7 T C 19: 10,526,008 M1T probably null Het
Cul3 T C 1: 80,271,565 D597G probably damaging Het
Dcaf11 T C 14: 55,565,507 V251A possibly damaging Het
Eno2 A T 6: 124,763,811 F218I probably damaging Het
Frmd6 A T 12: 70,899,444 R549* probably null Het
Fyb2 G A 4: 104,995,698 S461N possibly damaging Het
Gm5709 A T 3: 59,606,743 noncoding transcript Het
Hormad1 T C 3: 95,575,599 I132T probably benign Het
Itga7 G T 10: 128,953,531 R981L probably damaging Het
Itgbl1 T A 14: 123,827,894 N153K probably damaging Het
Itih1 T C 14: 30,933,360 E626G possibly damaging Het
Kcna2 A T 3: 107,105,401 T433S probably benign Het
Map4k5 A G 12: 69,813,153 V673A probably damaging Het
Mmp27 T A 9: 7,577,650 V281E probably benign Het
Nr2c1 A T 10: 94,190,738 I492F probably damaging Het
Olfr131 A G 17: 38,082,933 I15T probably benign Het
Olfr292 A G 7: 86,694,630 Y58C possibly damaging Het
Olfr457 C T 6: 42,471,774 V135M possibly damaging Het
Olfr703 A T 7: 106,844,649 I13F probably benign Het
Olfr77 G C 9: 19,920,500 C97S probably damaging Het
Olfr862 T C 9: 19,883,952 M118V probably benign Het
Olfr911-ps1 T A 9: 38,524,026 M98K probably damaging Het
Pank3 T C 11: 35,778,650 M237T probably damaging Het
Plekhh1 A G 12: 79,078,993 T1268A probably benign Het
Ptchd4 A G 17: 42,502,576 Y456C probably damaging Het
Rhcg C T 7: 79,599,729 V310M probably damaging Het
Ryr1 A T 7: 29,100,189 D906E probably damaging Het
Sez6l A T 5: 112,473,422 L262Q probably damaging Het
Shprh G A 10: 11,186,847 V1233I probably damaging Het
Slc3a1 A G 17: 85,037,207 E267G possibly damaging Het
Slc5a5 T A 8: 70,883,875 T616S probably benign Het
St5 G T 7: 109,557,426 P39Q probably damaging Het
Syne3 T G 12: 104,961,510 E318A probably benign Het
Tecpr2 A G 12: 110,896,228 T25A probably benign Het
Ubxn1 T A 19: 8,875,197 probably null Het
Unc5b C A 10: 60,772,583 R616L possibly damaging Het
Ush2a A G 1: 188,351,093 T278A probably benign Het
Utp14b A G 1: 78,664,999 T205A probably damaging Het
Vmn1r219 T C 13: 23,163,453 S271P possibly damaging Het
Vmn2r76 C T 7: 86,230,370 V241M probably benign Het
Zbtb24 G A 10: 41,462,279 G429D probably damaging Het
Zdhhc2 T C 8: 40,447,098 S68P probably damaging Het
Zfp719 G A 7: 43,584,254 M32I possibly damaging Het
Zfp975 T C 7: 42,662,526 N221S probably benign Het
Other mutations in Kat6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Kat6b APN 14 21668559 missense probably benign 0.00
IGL01128:Kat6b APN 14 21660860 missense probably benign
IGL02272:Kat6b APN 14 21626778 missense probably damaging 0.99
IGL02349:Kat6b APN 14 21637593 missense probably damaging 0.99
IGL02402:Kat6b APN 14 21631347 missense probably damaging 1.00
IGL02474:Kat6b APN 14 21669039 missense possibly damaging 0.95
IGL02516:Kat6b APN 14 21609868 splice site probably benign
IGL02666:Kat6b APN 14 21628870 missense probably damaging 1.00
IGL02971:Kat6b APN 14 21669758 missense probably damaging 1.00
IGL03075:Kat6b APN 14 21661570 nonsense probably null
IGL03274:Kat6b APN 14 21609763 missense possibly damaging 0.95
IGL03308:Kat6b APN 14 21624834 missense probably damaging 0.99
R0118:Kat6b UTSW 14 21669974 missense probably damaging 0.99
R0383:Kat6b UTSW 14 21669081 missense probably benign 0.02
R0441:Kat6b UTSW 14 21670233 missense probably damaging 1.00
R0457:Kat6b UTSW 14 21670530 missense probably damaging 0.96
R0558:Kat6b UTSW 14 21669421 missense probably benign 0.03
R0684:Kat6b UTSW 14 21668781 missense probably benign
R0755:Kat6b UTSW 14 21637593 missense probably damaging 0.99
R1216:Kat6b UTSW 14 21622040 nonsense probably null
R1479:Kat6b UTSW 14 21618956 missense probably benign 0.19
R1873:Kat6b UTSW 14 21516989 missense probably damaging 1.00
R1957:Kat6b UTSW 14 21628879 missense probably damaging 1.00
R2151:Kat6b UTSW 14 21668667 missense probably benign 0.02
R2152:Kat6b UTSW 14 21668667 missense probably benign 0.02
R2153:Kat6b UTSW 14 21668667 missense probably benign 0.02
R2154:Kat6b UTSW 14 21668667 missense probably benign 0.02
R2399:Kat6b UTSW 14 21662349 small deletion probably benign
R3740:Kat6b UTSW 14 21670044 missense probably damaging 0.99
R3771:Kat6b UTSW 14 21517098 missense probably damaging 1.00
R4178:Kat6b UTSW 14 21618904 nonsense probably null
R4261:Kat6b UTSW 14 21669669 missense probably damaging 1.00
R4551:Kat6b UTSW 14 21661448 missense probably damaging 1.00
R4724:Kat6b UTSW 14 21660962 missense probably benign
R5055:Kat6b UTSW 14 21516994 missense probably damaging 0.99
R5098:Kat6b UTSW 14 21619015 splice site probably benign
R5121:Kat6b UTSW 14 21619258 missense probably damaging 0.98
R5158:Kat6b UTSW 14 21669986 missense possibly damaging 0.93
R5488:Kat6b UTSW 14 21669264 missense probably damaging 1.00
R5489:Kat6b UTSW 14 21669264 missense probably damaging 1.00
R5653:Kat6b UTSW 14 21669372 missense probably benign 0.10
R5742:Kat6b UTSW 14 21668435 missense probably damaging 0.99
R5868:Kat6b UTSW 14 21634479 missense probably damaging 1.00
R5969:Kat6b UTSW 14 21670792 missense probably damaging 0.97
R6110:Kat6b UTSW 14 21670487 missense probably damaging 1.00
R6427:Kat6b UTSW 14 21517412 missense probably benign 0.24
R6457:Kat6b UTSW 14 21670680 missense probably damaging 1.00
R6639:Kat6b UTSW 14 21517494 missense possibly damaging 0.57
R6891:Kat6b UTSW 14 21669036 missense probably benign 0.01
R7784:Kat6b UTSW 14 21660841 missense probably damaging 1.00
R7916:Kat6b UTSW 14 21662349 small deletion probably benign
R7977:Kat6b UTSW 14 21669863 missense probably benign 0.00
R7987:Kat6b UTSW 14 21669863 missense probably benign 0.00
R8167:Kat6b UTSW 14 21669885 missense probably damaging 1.00
R8266:Kat6b UTSW 14 21516845 start gained probably benign
R8483:Kat6b UTSW 14 21669393 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAAGAGATCCTGTCGTCCAGAG -3'
(R):5'- GCACACGTTAGCAGTAAGCAGAACC -3'

Sequencing Primer
(F):5'- TCCAGAGTTAGCAGTAGGCAATC -3'
(R):5'- ATTGTGACACTGGACCACTG -3'
Posted On2013-07-30