Incidental Mutation 'R8053:Wapl'
ID 619213
Institutional Source Beutler Lab
Gene Symbol Wapl
Ensembl Gene ENSMUSG00000041408
Gene Name WAPL cohesin release factor
Synonyms A530089A20Rik, Wapal
MMRRC Submission 067490-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8053 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 34395885-34469940 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 34414278 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 380 (T380I)
Ref Sequence ENSEMBL: ENSMUSP00000040232 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048263] [ENSMUST00000090027] [ENSMUST00000169910]
AlphaFold Q65Z40
Predicted Effect probably damaging
Transcript: ENSMUST00000048263
AA Change: T380I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040232
Gene: ENSMUSG00000041408
AA Change: T380I

DomainStartEndE-ValueType
low complexity region 436 455 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
low complexity region 493 513 N/A INTRINSIC
Pfam:WAPL 645 1009 6.5e-153 PFAM
low complexity region 1018 1033 N/A INTRINSIC
low complexity region 1101 1112 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000090027
AA Change: T380I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000087481
Gene: ENSMUSG00000041408
AA Change: T380I

DomainStartEndE-ValueType
low complexity region 436 455 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
low complexity region 493 513 N/A INTRINSIC
Pfam:WAPL 639 1003 2.6e-153 PFAM
low complexity region 1012 1027 N/A INTRINSIC
low complexity region 1095 1106 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169910
AA Change: T380I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130547
Gene: ENSMUSG00000041408
AA Change: T380I

DomainStartEndE-ValueType
low complexity region 436 455 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
low complexity region 493 513 N/A INTRINSIC
Pfam:WAPL 647 1008 3.5e-120 PFAM
low complexity region 1018 1033 N/A INTRINSIC
low complexity region 1101 1112 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: Studies suggest that the protein encoded by this gene is important for the release of cohesin from chromatin. This gene product is thought to be essential for development, and reduced expression of this gene in cells causes defects in chromatin structure. High levels of expression of the human ortholog of this gene are observed in cervical cancers, and expression of the human ortholog of this gene in mice results in tumor formation. Alternative splicing results in multiple transcript variants encoding different protein isoforms. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for a targeted allele exhibit prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730507C01Rik C T 12: 18,583,728 (GRCm39) R263* probably null Het
Abca12 G A 1: 71,388,328 (GRCm39) R181* probably null Het
Adar T C 3: 89,654,592 (GRCm39) L908P probably damaging Het
Ankrd55 C T 13: 112,459,687 (GRCm39) R94C probably damaging Het
Aopep A T 13: 63,338,345 (GRCm39) K574* probably null Het
Carf A T 1: 60,167,197 (GRCm39) T177S probably benign Het
Ccdc162 C A 10: 41,520,577 (GRCm39) G693V probably benign Het
Ccng2 C G 5: 93,421,202 (GRCm39) S237R probably benign Het
Chd4 G T 6: 125,105,779 (GRCm39) E1799* probably null Het
Chrna3 T A 9: 54,922,674 (GRCm39) N378I probably benign Het
Clec4a2 T C 6: 123,104,998 (GRCm39) V96A probably benign Het
Cntnap5b T A 1: 100,318,402 (GRCm39) L683Q probably damaging Het
Crisp4 T A 1: 18,194,498 (GRCm39) Q208L probably benign Het
Crocc A G 4: 140,770,230 (GRCm39) probably null Het
Cyp2ab1 T C 16: 20,133,018 (GRCm39) E192G probably benign Het
Cyrib T C 15: 63,813,832 (GRCm39) D155G probably damaging Het
Daglb A G 5: 143,489,024 (GRCm39) K627R probably benign Het
Desi2 G A 1: 178,065,482 (GRCm39) W16* probably null Het
Dtx3l T C 16: 35,759,322 (GRCm39) probably benign Het
Elf2 A G 3: 51,215,551 (GRCm39) V53A possibly damaging Het
Eomes A G 9: 118,309,621 (GRCm39) D325G probably damaging Het
Etl4 A T 2: 20,666,774 (GRCm39) L60F probably damaging Het
Exoc4 A G 6: 33,309,191 (GRCm39) D271G probably benign Het
F5 A G 1: 164,020,338 (GRCm39) I938V probably benign Het
Fdxr T A 11: 115,160,665 (GRCm39) K290M probably benign Het
Fgd5 G A 6: 91,966,425 (GRCm39) S886N probably benign Het
Gm11595 G A 11: 99,662,954 (GRCm39) S242F unknown Het
Gm14322 A T 2: 177,411,424 (GRCm39) Q78L probably damaging Het
Gm8267 A T 14: 44,962,307 (GRCm39) S38T possibly damaging Het
Gpr75 A T 11: 30,841,559 (GRCm39) T155S probably benign Het
Hectd3 T C 4: 116,858,055 (GRCm39) S628P possibly damaging Het
Hrh2 A G 13: 54,368,104 (GRCm39) T27A probably benign Het
Kif16b G A 2: 142,695,634 (GRCm39) R157C probably damaging Het
Krt16 T C 11: 100,137,613 (GRCm39) Y364C probably damaging Het
Lrrc37 T A 11: 103,495,392 (GRCm39) K2809I unknown Het
Map2k5 T A 9: 63,250,707 (GRCm39) N95I probably benign Het
Melk A G 4: 44,318,109 (GRCm39) Y170C probably damaging Het
Mthfd1 T A 12: 76,327,282 (GRCm39) D123E probably damaging Het
Muc2 A T 7: 141,284,575 (GRCm39) Y827F probably benign Het
Myh15 T A 16: 48,963,302 (GRCm39) M1081K possibly damaging Het
Nbeal1 A G 1: 60,318,954 (GRCm39) T1998A probably damaging Het
Neb T A 2: 52,176,029 (GRCm39) T1477S possibly damaging Het
Nox4 C A 7: 87,019,255 (GRCm39) P416Q probably damaging Het
Or10ak7 A G 4: 118,791,308 (GRCm39) S246P probably damaging Het
Or1e31 T C 11: 73,689,822 (GRCm39) T254A probably benign Het
Or2j3 A T 17: 38,616,101 (GRCm39) F84I probably benign Het
Or4c123 A T 2: 89,127,540 (GRCm39) F25I possibly damaging Het
Or5g23 T C 2: 85,439,234 (GRCm39) T7A probably damaging Het
Pcdhga4 A G 18: 37,819,308 (GRCm39) K286E probably benign Het
Pde10a A G 17: 9,193,604 (GRCm39) T679A probably benign Het
Phc2 C T 4: 128,603,433 (GRCm39) Q188* probably null Het
Pramel12 C A 4: 143,144,208 (GRCm39) Q185K probably benign Het
Prdm15 A G 16: 97,636,807 (GRCm39) M170T probably benign Het
Rab20 G T 8: 11,504,443 (GRCm39) Q86K probably damaging Het
Rev1 T C 1: 38,102,222 (GRCm39) I714V possibly damaging Het
Rexo2 A G 9: 48,386,418 (GRCm39) probably null Het
Rnf213 A G 11: 119,293,473 (GRCm39) K75E Het
Sdk2 C T 11: 113,745,177 (GRCm39) R706Q probably damaging Het
Sema3c C T 5: 17,860,020 (GRCm39) T95I probably benign Het
Sh3rf2 T A 18: 42,286,087 (GRCm39) S527T probably damaging Het
Sis A T 3: 72,856,901 (GRCm39) Y434* probably null Het
Slc16a6 G A 11: 109,349,395 (GRCm39) T222I probably damaging Het
Smad6 A G 9: 63,927,789 (GRCm39) L173P probably damaging Het
Sugct T A 13: 17,476,554 (GRCm39) N310I probably damaging Het
Syne1 T A 10: 5,002,658 (GRCm39) K259* probably null Het
Taar6 A G 10: 23,861,144 (GRCm39) V134A possibly damaging Het
Tmem199 A G 11: 78,398,612 (GRCm39) I184T possibly damaging Het
Tnrc18 G T 5: 142,736,385 (GRCm39) D1530E unknown Het
Tnxb G A 17: 34,923,153 (GRCm39) V2579M probably damaging Het
Vangl2 A G 1: 171,832,303 (GRCm39) F518L probably damaging Het
Vmn2r40 T C 7: 8,911,245 (GRCm39) T683A Het
Zfp874b A T 13: 67,622,217 (GRCm39) H360Q probably damaging Het
Other mutations in Wapl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Wapl APN 14 34,414,593 (GRCm39) missense probably benign 0.00
IGL00539:Wapl APN 14 34,416,965 (GRCm39) missense probably damaging 1.00
IGL00846:Wapl APN 14 34,414,701 (GRCm39) splice site probably benign
IGL01070:Wapl APN 14 34,467,579 (GRCm39) unclassified probably benign
IGL01516:Wapl APN 14 34,414,038 (GRCm39) missense probably damaging 1.00
IGL02021:Wapl APN 14 34,444,293 (GRCm39) missense probably benign
IGL02209:Wapl APN 14 34,399,218 (GRCm39) missense possibly damaging 0.46
IGL02309:Wapl APN 14 34,466,820 (GRCm39) missense probably damaging 0.98
IGL02471:Wapl APN 14 34,413,877 (GRCm39) missense possibly damaging 0.68
IGL02965:Wapl APN 14 34,461,181 (GRCm39) intron probably benign
IGL03076:Wapl APN 14 34,414,046 (GRCm39) missense probably benign 0.26
IGL03197:Wapl APN 14 34,467,588 (GRCm39) missense possibly damaging 0.77
Mcclintock UTSW 14 34,452,619 (GRCm39) critical splice donor site probably null
Tatum UTSW 14 34,451,152 (GRCm39) missense probably damaging 1.00
R0045:Wapl UTSW 14 34,455,751 (GRCm39) missense probably benign 0.18
R0278:Wapl UTSW 14 34,414,569 (GRCm39) missense possibly damaging 0.68
R0335:Wapl UTSW 14 34,414,281 (GRCm39) missense probably damaging 0.99
R1018:Wapl UTSW 14 34,413,863 (GRCm39) missense possibly damaging 0.91
R1295:Wapl UTSW 14 34,446,726 (GRCm39) missense probably damaging 1.00
R1553:Wapl UTSW 14 34,451,147 (GRCm39) missense probably damaging 1.00
R1868:Wapl UTSW 14 34,414,415 (GRCm39) missense probably benign 0.00
R1909:Wapl UTSW 14 34,413,869 (GRCm39) missense probably damaging 1.00
R2698:Wapl UTSW 14 34,413,734 (GRCm39) missense probably benign
R2990:Wapl UTSW 14 34,458,665 (GRCm39) missense probably damaging 0.98
R3121:Wapl UTSW 14 34,451,172 (GRCm39) missense possibly damaging 0.93
R3122:Wapl UTSW 14 34,451,172 (GRCm39) missense possibly damaging 0.93
R3147:Wapl UTSW 14 34,447,106 (GRCm39) missense probably damaging 1.00
R3732:Wapl UTSW 14 34,458,721 (GRCm39) missense probably damaging 0.99
R3732:Wapl UTSW 14 34,458,721 (GRCm39) missense probably damaging 0.99
R3733:Wapl UTSW 14 34,458,721 (GRCm39) missense probably damaging 0.99
R3878:Wapl UTSW 14 34,414,104 (GRCm39) missense probably damaging 1.00
R4034:Wapl UTSW 14 34,459,871 (GRCm39) missense possibly damaging 0.92
R4934:Wapl UTSW 14 34,414,052 (GRCm39) missense probably benign 0.11
R5079:Wapl UTSW 14 34,446,714 (GRCm39) missense probably damaging 1.00
R5104:Wapl UTSW 14 34,414,016 (GRCm39) nonsense probably null
R5113:Wapl UTSW 14 34,446,711 (GRCm39) missense probably damaging 1.00
R5121:Wapl UTSW 14 34,399,119 (GRCm39) missense probably benign 0.01
R5222:Wapl UTSW 14 34,458,642 (GRCm39) nonsense probably null
R5299:Wapl UTSW 14 34,455,765 (GRCm39) critical splice donor site probably null
R5387:Wapl UTSW 14 34,399,252 (GRCm39) missense probably benign 0.00
R5541:Wapl UTSW 14 34,452,619 (GRCm39) critical splice donor site probably null
R5618:Wapl UTSW 14 34,413,863 (GRCm39) missense possibly damaging 0.91
R5802:Wapl UTSW 14 34,414,277 (GRCm39) missense probably damaging 1.00
R6029:Wapl UTSW 14 34,461,204 (GRCm39) missense possibly damaging 0.94
R6292:Wapl UTSW 14 34,451,152 (GRCm39) missense probably damaging 1.00
R6482:Wapl UTSW 14 34,414,649 (GRCm39) missense probably benign 0.01
R6487:Wapl UTSW 14 34,414,249 (GRCm39) missense probably damaging 1.00
R6925:Wapl UTSW 14 34,399,320 (GRCm39) missense probably benign 0.31
R6937:Wapl UTSW 14 34,444,311 (GRCm39) missense probably benign 0.01
R7080:Wapl UTSW 14 34,414,313 (GRCm39) missense probably benign 0.03
R7203:Wapl UTSW 14 34,458,648 (GRCm39) missense probably benign
R7944:Wapl UTSW 14 34,399,105 (GRCm39) missense probably benign 0.00
R7945:Wapl UTSW 14 34,399,105 (GRCm39) missense probably benign 0.00
R7969:Wapl UTSW 14 34,452,604 (GRCm39) missense probably damaging 1.00
R8038:Wapl UTSW 14 34,413,639 (GRCm39) missense probably benign
R8688:Wapl UTSW 14 34,414,549 (GRCm39) missense possibly damaging 0.94
R8864:Wapl UTSW 14 34,414,159 (GRCm39) missense probably benign 0.03
R8988:Wapl UTSW 14 34,451,139 (GRCm39) missense probably damaging 1.00
R9072:Wapl UTSW 14 34,399,417 (GRCm39) missense possibly damaging 0.81
R9197:Wapl UTSW 14 34,444,244 (GRCm39) missense probably damaging 1.00
R9259:Wapl UTSW 14 34,463,052 (GRCm39) missense probably benign 0.00
R9545:Wapl UTSW 14 34,399,050 (GRCm39) missense probably damaging 1.00
R9613:Wapl UTSW 14 34,453,520 (GRCm39) missense probably benign 0.29
R9624:Wapl UTSW 14 34,414,063 (GRCm39) missense possibly damaging 0.89
Z1177:Wapl UTSW 14 34,467,647 (GRCm39) makesense probably null
Predicted Primers PCR Primer
(F):5'- TGGCACCAGTCAGTCCTTAG -3'
(R):5'- TCGCTGAGATCGTCAAAGC -3'

Sequencing Primer
(F):5'- AGTCAGTCCTTAGCCAAAGC -3'
(R):5'- TTGTAATTAGAACTTCCAGAACCCC -3'
Posted On 2020-01-23