Incidental Mutation 'R8053:Pcdhga4'
ID619223
Institutional Source Beutler Lab
Gene Symbol Pcdhga4
Ensembl Gene ENSMUSG00000103677
Gene Nameprotocadherin gamma subfamily A, 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R8053 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location37685210-37841873 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37686255 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 286 (K286E)
Ref Sequence ENSEMBL: ENSMUSP00000142140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073447] [ENSMUST00000115661] [ENSMUST00000192931] [ENSMUST00000193869] [ENSMUST00000194190] [ENSMUST00000194418] [ENSMUST00000194544] [ENSMUST00000195112]
Predicted Effect probably benign
Transcript: ENSMUST00000073447
SMART Domains Protein: ENSMUSP00000073150
Gene: ENSMUSG00000104346

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CA 42 128 2.15e-2 SMART
CA 152 237 4.8e-13 SMART
CA 261 342 9.36e-25 SMART
CA 366 447 6.62e-25 SMART
CA 471 557 6.72e-26 SMART
CA 588 666 2.15e-15 SMART
Pfam:Cadherin_C_2 685 768 4.8e-24 PFAM
Pfam:Cadherin_tail 805 928 8.1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192931
SMART Domains Protein: ENSMUSP00000141348
Gene: ENSMUSG00000103037

DomainStartEndE-ValueType
CA 36 119 8e-3 SMART
CA 143 228 1.34e-20 SMART
CA 252 333 1.52e-24 SMART
CA 357 438 9.22e-24 SMART
CA 462 548 1.24e-24 SMART
CA 579 660 1.3e-9 SMART
transmembrane domain 679 701 N/A INTRINSIC
low complexity region 899 918 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193869
SMART Domains Protein: ENSMUSP00000141482
Gene: ENSMUSG00000103332

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 45 131 1.64e-2 SMART
CA 155 240 6.42e-23 SMART
CA 264 345 1.76e-20 SMART
CA 369 450 2.27e-23 SMART
CA 474 560 1.5e-23 SMART
CA 591 669 1.17e-16 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 912 931 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194190
SMART Domains Protein: ENSMUSP00000142062
Gene: ENSMUSG00000103144

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 31 131 3.16e-2 SMART
CA 155 240 5.39e-16 SMART
CA 264 345 6.72e-26 SMART
CA 369 450 1.32e-24 SMART
CA 474 560 4.17e-22 SMART
CA 591 669 4.48e-13 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 912 931 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194418
AA Change: K286E

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000142140
Gene: ENSMUSG00000103677
AA Change: K286E

DomainStartEndE-ValueType
CA 44 130 1.64e-2 SMART
CA 154 239 3.93e-18 SMART
CA 263 344 5.22e-23 SMART
CA 368 449 5.02e-25 SMART
CA 473 559 2.07e-26 SMART
CA 590 668 6.84e-18 SMART
transmembrane domain 690 712 N/A INTRINSIC
low complexity region 911 930 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000195112
SMART Domains Protein: ENSMUSP00000141449
Gene: ENSMUSG00000102748

DomainStartEndE-ValueType
CA 24 130 8.18e-3 SMART
CA 154 239 1.39e-18 SMART
CA 263 344 7.91e-23 SMART
CA 368 449 2.27e-23 SMART
CA 473 559 1.24e-24 SMART
CA 590 671 1.3e-9 SMART
transmembrane domain 690 712 N/A INTRINSIC
low complexity region 909 928 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195163
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin gamma gene cluster, one of three related clusters tandemly linked on chromosome five. These gene clusters have an immunoglobulin-like organization, suggesting that a novel mechanism may be involved in their regulation and expression. The gamma gene cluster includes 22 genes divided into 3 subfamilies. Subfamily A contains 12 genes, subfamily B contains 7 genes and 2 pseudogenes, and the more distantly related subfamily C contains 3 genes. The tandem array of 22 large, variable region exons are followed by a constant region, containing 3 exons shared by all genes in the cluster. Each variable region exon encodes the extracellular region, which includes 6 cadherin ectodomains and a transmembrane region. The constant region exons encode the common cytoplasmic region. These neural cadherin-like cell adhesion proteins most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been described for the gamma cluster genes. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A T 13: 63,190,531 K574* probably null Het
5730507C01Rik C T 12: 18,533,727 R263* probably null Het
Abca12 G A 1: 71,349,169 R181* probably null Het
Adar T C 3: 89,747,285 L908P probably damaging Het
Ankrd55 C T 13: 112,323,153 R94C probably damaging Het
Carf A T 1: 60,128,038 T177S probably benign Het
Ccdc162 C A 10: 41,644,581 G693V probably benign Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Chd4 G T 6: 125,128,816 E1799* probably null Het
Chrna3 T A 9: 55,015,390 N378I probably benign Het
Clec4a2 T C 6: 123,128,039 V96A probably benign Het
Cntnap5b T A 1: 100,390,677 L683Q probably damaging Het
Crisp4 T A 1: 18,124,274 Q208L probably benign Het
Crocc A G 4: 141,042,919 probably null Het
Cyp2ab1 T C 16: 20,314,268 E192G probably benign Het
Daglb A G 5: 143,503,269 K627R probably benign Het
Desi2 G A 1: 178,237,916 W16* probably null Het
Dtx3l T C 16: 35,938,952 probably benign Het
Elf2 A G 3: 51,308,130 V53A possibly damaging Het
Eomes A G 9: 118,480,553 D325G probably damaging Het
Etl4 A T 2: 20,661,963 L60F probably damaging Het
Exoc4 A G 6: 33,332,256 D271G probably benign Het
F5 A G 1: 164,192,769 I938V probably benign Het
Fam49b T C 15: 63,941,983 D155G probably damaging Het
Fdxr T A 11: 115,269,839 K290M probably benign Het
Fgd5 G A 6: 91,989,444 S886N probably benign Het
Gm11595 G A 11: 99,772,128 S242F unknown Het
Gm14322 A T 2: 177,769,631 Q78L probably damaging Het
Gm8267 A T 14: 44,724,850 S38T possibly damaging Het
Gm884 T A 11: 103,604,566 K2809I unknown Het
Gpr75 A T 11: 30,891,559 T155S probably benign Het
Hectd3 T C 4: 117,000,858 S628P possibly damaging Het
Hrh2 A G 13: 54,214,085 T27A probably benign Het
Kif16b G A 2: 142,853,714 R157C probably damaging Het
Krt16 T C 11: 100,246,787 Y364C probably damaging Het
Map2k5 T A 9: 63,343,425 N95I probably benign Het
Melk A G 4: 44,318,109 Y170C probably damaging Het
Mthfd1 T A 12: 76,280,508 D123E probably damaging Het
Muc2 A T 7: 141,698,332 Y827F probably benign Het
Myh15 T A 16: 49,142,939 M1081K possibly damaging Het
Nbeal1 A G 1: 60,279,795 T1998A probably damaging Het
Neb T A 2: 52,286,017 T1477S possibly damaging Het
Nox4 C A 7: 87,370,047 P416Q probably damaging Het
Olfr1000 T C 2: 85,608,890 T7A probably damaging Het
Olfr1230 A T 2: 89,297,196 F25I possibly damaging Het
Olfr1328 A G 4: 118,934,111 S246P probably damaging Het
Olfr137 A T 17: 38,305,210 F84I probably benign Het
Olfr391-ps T C 11: 73,798,996 T254A probably benign Het
Pde10a A G 17: 8,974,772 T679A probably benign Het
Phc2 C T 4: 128,709,640 Q188* probably null Het
Pramef8 C A 4: 143,417,638 Q185K probably benign Het
Prdm15 A G 16: 97,835,607 M170T probably benign Het
Rab20 G T 8: 11,454,443 Q86K probably damaging Het
Rev1 T C 1: 38,063,141 I714V possibly damaging Het
Rexo2 A G 9: 48,475,118 probably null Het
Rnf213 A G 11: 119,402,647 K75E Het
Sdk2 C T 11: 113,854,351 R706Q probably damaging Het
Sema3c C T 5: 17,655,022 T95I probably benign Het
Sh3rf2 T A 18: 42,153,022 S527T probably damaging Het
Sis A T 3: 72,949,568 Y434* probably null Het
Slc16a6 G A 11: 109,458,569 T222I probably damaging Het
Smad6 A G 9: 64,020,507 L173P probably damaging Het
Sugct T A 13: 17,301,969 N310I probably damaging Het
Syne1 T A 10: 5,052,658 K259* probably null Het
Taar6 A G 10: 23,985,246 V134A possibly damaging Het
Tmem199 A G 11: 78,507,786 I184T possibly damaging Het
Tnrc18 G T 5: 142,750,630 D1530E unknown Het
Tnxb G A 17: 34,704,179 V2579M probably damaging Het
Vangl2 A G 1: 172,004,736 F518L probably damaging Het
Vmn2r40 T C 7: 8,908,246 T683A Het
Wapl C T 14: 34,692,321 T380I probably damaging Het
Zfp874b A T 13: 67,474,098 H360Q probably damaging Het
Other mutations in Pcdhga4
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT1430001:Pcdhga4 UTSW 18 37686214 missense probably benign 0.00
R3828:Pcdhga4 UTSW 18 37687601 missense possibly damaging 0.62
R3970:Pcdhga4 UTSW 18 37687601 missense possibly damaging 0.62
R4080:Pcdhga4 UTSW 18 37685779 missense probably damaging 1.00
R4356:Pcdhga4 UTSW 18 37687611 missense probably damaging 1.00
R4834:Pcdhga4 UTSW 18 37685437 missense probably benign 0.01
R4983:Pcdhga4 UTSW 18 37686519 missense probably damaging 1.00
R5076:Pcdhga4 UTSW 18 37685595 missense probably benign 0.43
R5186:Pcdhga4 UTSW 18 37687426 missense probably benign 0.07
R5194:Pcdhga4 UTSW 18 37687741 missense probably benign 0.08
R5326:Pcdhga4 UTSW 18 37686598 missense probably damaging 0.98
R5333:Pcdhga4 UTSW 18 37685424 missense probably benign 0.00
R5373:Pcdhga4 UTSW 18 37685596 missense probably damaging 1.00
R5374:Pcdhga4 UTSW 18 37685596 missense probably damaging 1.00
R5419:Pcdhga4 UTSW 18 37686745 missense probably damaging 1.00
R5542:Pcdhga4 UTSW 18 37686598 missense probably damaging 0.98
R5878:Pcdhga4 UTSW 18 37687686 missense probably benign 0.03
R5996:Pcdhga4 UTSW 18 37685938 missense probably benign 0.03
R6056:Pcdhga4 UTSW 18 37686330 missense probably benign 0.00
R6083:Pcdhga4 UTSW 18 37687425 missense probably damaging 0.98
R6155:Pcdhga4 UTSW 18 37686493 missense probably damaging 0.98
R6208:Pcdhga4 UTSW 18 37686709 missense probably damaging 1.00
R6306:Pcdhga4 UTSW 18 37685913 missense probably damaging 1.00
R6580:Pcdhga4 UTSW 18 37687317 missense possibly damaging 0.93
R6936:Pcdhga4 UTSW 18 37687405 missense possibly damaging 0.84
R7132:Pcdhga4 UTSW 18 37687377 missense probably damaging 1.00
R7159:Pcdhga4 UTSW 18 37686919 missense probably damaging 1.00
R7257:Pcdhga4 UTSW 18 37687398 missense probably damaging 0.99
R7263:Pcdhga4 UTSW 18 37686820 missense probably benign 0.42
R7825:Pcdhga4 UTSW 18 37687321 missense probably damaging 1.00
R7882:Pcdhga4 UTSW 18 37686628 missense probably damaging 1.00
R7916:Pcdhga4 UTSW 18 37685449 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- CTCTGGTACTGCCACAATTCAAG -3'
(R):5'- AAGCTTCCTGGATAGAGCTGG -3'

Sequencing Primer
(F):5'- TTCAAGTAACACTCGTGGACAC -3'
(R):5'- AGAGAGGTGACTGTGACTTCC -3'
Posted On2020-01-23