Incidental Mutation 'R0662:Itgbl1'
ID61924
Institutional Source Beutler Lab
Gene Symbol Itgbl1
Ensembl Gene ENSMUSG00000032925
Gene Nameintegrin, beta-like 1
SynonymsB930011D01Rik, with EGF-like repeat domains
MMRRC Submission 038847-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R0662 (G1)
Quality Score149
Status Not validated
Chromosome14
Chromosomal Location123659971-123975618 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 123827894 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 153 (N153K)
Ref Sequence ENSEMBL: ENSMUSP00000121659 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049681] [ENSMUST00000132026] [ENSMUST00000142161]
Predicted Effect probably benign
Transcript: ENSMUST00000049681
AA Change: N153K

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000059019
Gene: ENSMUSG00000032925
AA Change: N153K

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
internal_repeat_1 62 164 7.9e-12 PROSPERO
EGF_like 184 217 6.95e1 SMART
EGF 275 311 2.25e1 SMART
low complexity region 335 348 N/A INTRINSIC
Pfam:EGF_2 368 398 3.6e-8 PFAM
low complexity region 423 438 N/A INTRINSIC
low complexity region 448 456 N/A INTRINSIC
Blast:EGF_like 457 486 4e-9 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000132026
AA Change: N76K

PolyPhen 2 Score 0.811 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000115455
Gene: ENSMUSG00000032925
AA Change: N76K

DomainStartEndE-ValueType
internal_repeat_2 22 50 3.54e-8 PROSPERO
internal_repeat_1 23 87 7.45e-14 PROSPERO
low complexity region 101 126 N/A INTRINSIC
EGF 151 187 2.25e1 SMART
low complexity region 211 224 N/A INTRINSIC
Pfam:EGF_2 239 274 1.5e-7 PFAM
low complexity region 299 314 N/A INTRINSIC
low complexity region 324 332 N/A INTRINSIC
internal_repeat_2 334 362 3.54e-8 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000142161
AA Change: N153K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000121659
Gene: ENSMUSG00000032925
AA Change: N153K

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
PDB:4G1E|B 59 171 1e-17 PDB
Blast:EGF_like 90 127 5e-15 BLAST
low complexity region 178 192 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.6%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a beta integrin-related protein that is a member of the EGF-like protein family. The encoded protein contains integrin-like cysteine-rich repeats. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf T C 19: 31,920,938 S241P probably benign Het
Ankrd53 G T 6: 83,763,643 V83L probably damaging Het
Armcx2 G A X: 134,805,636 T416I possibly damaging Het
C4b G A 17: 34,730,888 R1441C probably damaging Het
Cacng3 T C 7: 122,768,359 I154T probably damaging Het
Cand2 A G 6: 115,787,210 D315G probably benign Het
Celsr2 A T 3: 108,398,520 S2089R probably damaging Het
Chd9 A C 8: 90,977,676 K247Q probably damaging Het
Chil1 A C 1: 134,188,573 S263R probably damaging Het
Clec12b A C 6: 129,376,237 C262W probably damaging Het
Cpsf7 T C 19: 10,526,008 M1T probably null Het
Cul3 T C 1: 80,271,565 D597G probably damaging Het
Dcaf11 T C 14: 55,565,507 V251A possibly damaging Het
Eno2 A T 6: 124,763,811 F218I probably damaging Het
Frmd6 A T 12: 70,899,444 R549* probably null Het
Fyb2 G A 4: 104,995,698 S461N possibly damaging Het
Gm5709 A T 3: 59,606,743 noncoding transcript Het
Hormad1 T C 3: 95,575,599 I132T probably benign Het
Itga7 G T 10: 128,953,531 R981L probably damaging Het
Itih1 T C 14: 30,933,360 E626G possibly damaging Het
Kat6b AGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGA 14: 21,662,349 probably benign Het
Kcna2 A T 3: 107,105,401 T433S probably benign Het
Map4k5 A G 12: 69,813,153 V673A probably damaging Het
Mmp27 T A 9: 7,577,650 V281E probably benign Het
Nr2c1 A T 10: 94,190,738 I492F probably damaging Het
Olfr131 A G 17: 38,082,933 I15T probably benign Het
Olfr292 A G 7: 86,694,630 Y58C possibly damaging Het
Olfr457 C T 6: 42,471,774 V135M possibly damaging Het
Olfr703 A T 7: 106,844,649 I13F probably benign Het
Olfr77 G C 9: 19,920,500 C97S probably damaging Het
Olfr862 T C 9: 19,883,952 M118V probably benign Het
Olfr911-ps1 T A 9: 38,524,026 M98K probably damaging Het
Pank3 T C 11: 35,778,650 M237T probably damaging Het
Plekhh1 A G 12: 79,078,993 T1268A probably benign Het
Ptchd4 A G 17: 42,502,576 Y456C probably damaging Het
Rhcg C T 7: 79,599,729 V310M probably damaging Het
Ryr1 A T 7: 29,100,189 D906E probably damaging Het
Sez6l A T 5: 112,473,422 L262Q probably damaging Het
Shprh G A 10: 11,186,847 V1233I probably damaging Het
Slc3a1 A G 17: 85,037,207 E267G possibly damaging Het
Slc5a5 T A 8: 70,883,875 T616S probably benign Het
St5 G T 7: 109,557,426 P39Q probably damaging Het
Syne3 T G 12: 104,961,510 E318A probably benign Het
Tecpr2 A G 12: 110,896,228 T25A probably benign Het
Ubxn1 T A 19: 8,875,197 probably null Het
Unc5b C A 10: 60,772,583 R616L possibly damaging Het
Ush2a A G 1: 188,351,093 T278A probably benign Het
Utp14b A G 1: 78,664,999 T205A probably damaging Het
Vmn1r219 T C 13: 23,163,453 S271P possibly damaging Het
Vmn2r76 C T 7: 86,230,370 V241M probably benign Het
Zbtb24 G A 10: 41,462,279 G429D probably damaging Het
Zdhhc2 T C 8: 40,447,098 S68P probably damaging Het
Zfp719 G A 7: 43,584,254 M32I possibly damaging Het
Zfp975 T C 7: 42,662,526 N221S probably benign Het
Other mutations in Itgbl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00673:Itgbl1 APN 14 123846432 splice site probably benign
IGL01290:Itgbl1 APN 14 123966725 missense probably benign 0.02
IGL01618:Itgbl1 APN 14 123827799 missense possibly damaging 0.88
IGL02024:Itgbl1 APN 14 123857492 missense probably damaging 1.00
IGL02192:Itgbl1 APN 14 123843926 missense probably damaging 1.00
IGL02215:Itgbl1 APN 14 123972141 missense probably benign 0.01
IGL02400:Itgbl1 APN 14 123846526 missense probably damaging 1.00
IGL02483:Itgbl1 APN 14 123827743 splice site probably benign
H8441:Itgbl1 UTSW 14 123973287 missense probably damaging 1.00
R0137:Itgbl1 UTSW 14 123840686 critical splice donor site probably null
R0193:Itgbl1 UTSW 14 123846546 missense probably benign 0.09
R0355:Itgbl1 UTSW 14 123840585 nonsense probably null
R0598:Itgbl1 UTSW 14 123857436 missense possibly damaging 0.93
R0689:Itgbl1 UTSW 14 123827847 missense possibly damaging 0.65
R1385:Itgbl1 UTSW 14 123661511 splice site probably null
R1957:Itgbl1 UTSW 14 123966678 missense probably damaging 1.00
R3739:Itgbl1 UTSW 14 123966678 missense probably damaging 1.00
R3842:Itgbl1 UTSW 14 123840565 missense possibly damaging 0.92
R4434:Itgbl1 UTSW 14 123972199 missense probably damaging 1.00
R4463:Itgbl1 UTSW 14 123840668 missense probably damaging 0.97
R4696:Itgbl1 UTSW 14 123966708 missense probably damaging 1.00
R4937:Itgbl1 UTSW 14 123973368 missense probably benign 0.12
R5087:Itgbl1 UTSW 14 123966739 missense possibly damaging 0.52
R5747:Itgbl1 UTSW 14 123972164 nonsense probably null
R6020:Itgbl1 UTSW 14 123846565 missense probably damaging 0.99
R6169:Itgbl1 UTSW 14 123660378 missense probably benign 0.17
R6758:Itgbl1 UTSW 14 123857489 missense probably benign 0.23
R7213:Itgbl1 UTSW 14 123973297 missense probably damaging 1.00
R7259:Itgbl1 UTSW 14 123843904 missense probably damaging 0.96
R7378:Itgbl1 UTSW 14 123857489 missense probably benign 0.23
R7461:Itgbl1 UTSW 14 123827799 missense possibly damaging 0.88
R7664:Itgbl1 UTSW 14 123846550 missense probably damaging 1.00
R7841:Itgbl1 UTSW 14 123972233 critical splice donor site probably null
R7924:Itgbl1 UTSW 14 123972233 critical splice donor site probably null
R8115:Itgbl1 UTSW 14 123857543 missense probably damaging 1.00
V1024:Itgbl1 UTSW 14 123973287 missense probably damaging 1.00
X0012:Itgbl1 UTSW 14 123661305 missense probably benign 0.01
X0017:Itgbl1 UTSW 14 123972211 missense possibly damaging 0.81
Z1176:Itgbl1 UTSW 14 123954672 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCAGGCCACGGTAATTGTGACTGC -3'
(R):5'- ACAGTTGAAGCTGAACCTCCAGGG -3'

Sequencing Primer
(F):5'- GTAATTGTGACTGCGGCAAG -3'
(R):5'- cacacacacacacacacac -3'
Posted On2013-07-30