Incidental Mutation 'R0662:C4b'
ID 61925
Institutional Source Beutler Lab
Gene Symbol C4b
Ensembl Gene ENSMUSG00000073418
Gene Name complement C4B (Chido blood group)
Synonyms Ss, C4
MMRRC Submission 038847-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0662 (G1)
Quality Score 106
Status Not validated
Chromosome 17
Chromosomal Location 34947354-34962856 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 34949862 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 1441 (R1441C)
Ref Sequence ENSEMBL: ENSMUSP00000069418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069507]
AlphaFold P01029
Predicted Effect probably damaging
Transcript: ENSMUST00000069507
AA Change: R1441C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000069418
Gene: ENSMUSG00000073418
AA Change: R1441C

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:A2M_N 138 231 2e-19 PFAM
A2M_N_2 470 609 2.87e-26 SMART
ANATO 700 734 3.58e-12 SMART
low complexity region 761 771 N/A INTRINSIC
A2M 779 867 1.46e-27 SMART
Pfam:Thiol-ester_cl 995 1024 7.7e-13 PFAM
Pfam:A2M_comp 1047 1313 1.3e-82 PFAM
low complexity region 1441 1447 N/A INTRINSIC
A2M_recep 1475 1564 1.03e-36 SMART
C345C 1608 1720 5.69e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173057
SMART Domains Protein: ENSMUSP00000134611
Gene: ENSMUSG00000073418

DomainStartEndE-ValueType
Pfam:A2M 1 62 6.5e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173669
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.6%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous C4 deficient mice have compromised immune responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf T C 19: 31,898,338 (GRCm39) S241P probably benign Het
Ankrd53 G T 6: 83,740,625 (GRCm39) V83L probably damaging Het
Armcx2 G A X: 133,706,385 (GRCm39) T416I possibly damaging Het
Cacng3 T C 7: 122,367,582 (GRCm39) I154T probably damaging Het
Cand2 A G 6: 115,764,171 (GRCm39) D315G probably benign Het
Celsr2 A T 3: 108,305,836 (GRCm39) S2089R probably damaging Het
Chd9 A C 8: 91,704,304 (GRCm39) K247Q probably damaging Het
Chi3l1 A C 1: 134,116,311 (GRCm39) S263R probably damaging Het
Clec12b A C 6: 129,353,200 (GRCm39) C262W probably damaging Het
Cpsf7 T C 19: 10,503,372 (GRCm39) M1T probably null Het
Cul3 T C 1: 80,249,282 (GRCm39) D597G probably damaging Het
Dcaf11 T C 14: 55,802,964 (GRCm39) V251A possibly damaging Het
Dennd2b G T 7: 109,156,633 (GRCm39) P39Q probably damaging Het
Eno2 A T 6: 124,740,774 (GRCm39) F218I probably damaging Het
Frmd6 A T 12: 70,946,218 (GRCm39) R549* probably null Het
Fyb2 G A 4: 104,852,895 (GRCm39) S461N possibly damaging Het
Gm5709 A T 3: 59,514,164 (GRCm39) noncoding transcript Het
Hormad1 T C 3: 95,482,910 (GRCm39) I132T probably benign Het
Itga7 G T 10: 128,789,400 (GRCm39) R981L probably damaging Het
Itgbl1 T A 14: 124,065,306 (GRCm39) N153K probably damaging Het
Itih1 T C 14: 30,655,317 (GRCm39) E626G possibly damaging Het
Kat6b AGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGA 14: 21,712,417 (GRCm39) probably benign Het
Kcna2 A T 3: 107,012,717 (GRCm39) T433S probably benign Het
Map4k5 A G 12: 69,859,927 (GRCm39) V673A probably damaging Het
Mmp27 T A 9: 7,577,651 (GRCm39) V281E probably benign Het
Nr2c1 A T 10: 94,026,600 (GRCm39) I492F probably damaging Het
Or14c39 A G 7: 86,343,838 (GRCm39) Y58C possibly damaging Het
Or2ag19 A T 7: 106,443,856 (GRCm39) I13F probably benign Het
Or2r3 C T 6: 42,448,708 (GRCm39) V135M possibly damaging Het
Or2y3 A G 17: 38,393,824 (GRCm39) I15T probably benign Het
Or7d10 G C 9: 19,831,796 (GRCm39) C97S probably damaging Het
Or7e170 T C 9: 19,795,248 (GRCm39) M118V probably benign Het
Or8b47 T A 9: 38,435,322 (GRCm39) M98K probably damaging Het
Pank3 T C 11: 35,669,477 (GRCm39) M237T probably damaging Het
Plekhh1 A G 12: 79,125,767 (GRCm39) T1268A probably benign Het
Ptchd4 A G 17: 42,813,467 (GRCm39) Y456C probably damaging Het
Rhcg C T 7: 79,249,477 (GRCm39) V310M probably damaging Het
Ryr1 A T 7: 28,799,614 (GRCm39) D906E probably damaging Het
Sez6l A T 5: 112,621,288 (GRCm39) L262Q probably damaging Het
Shprh G A 10: 11,062,591 (GRCm39) V1233I probably damaging Het
Slc3a1 A G 17: 85,344,635 (GRCm39) E267G possibly damaging Het
Slc5a5 T A 8: 71,336,519 (GRCm39) T616S probably benign Het
Syne3 T G 12: 104,927,769 (GRCm39) E318A probably benign Het
Tecpr2 A G 12: 110,862,662 (GRCm39) T25A probably benign Het
Ubxn1 T A 19: 8,852,561 (GRCm39) probably null Het
Unc5b C A 10: 60,608,362 (GRCm39) R616L possibly damaging Het
Ush2a A G 1: 188,083,290 (GRCm39) T278A probably benign Het
Utp14b A G 1: 78,642,716 (GRCm39) T205A probably damaging Het
Vmn1r219 T C 13: 23,347,623 (GRCm39) S271P possibly damaging Het
Vmn2r76 C T 7: 85,879,578 (GRCm39) V241M probably benign Het
Zbtb24 G A 10: 41,338,275 (GRCm39) G429D probably damaging Het
Zdhhc2 T C 8: 40,900,139 (GRCm39) S68P probably damaging Het
Zfp719 G A 7: 43,233,678 (GRCm39) M32I possibly damaging Het
Zfp975 T C 7: 42,311,950 (GRCm39) N221S probably benign Het
Other mutations in C4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:C4b APN 17 34,953,402 (GRCm39) missense probably damaging 1.00
IGL00433:C4b APN 17 34,961,015 (GRCm39) missense possibly damaging 0.75
IGL00471:C4b APN 17 34,953,403 (GRCm39) missense probably damaging 1.00
IGL00515:C4b APN 17 34,947,865 (GRCm39) missense probably damaging 1.00
IGL01599:C4b APN 17 34,961,993 (GRCm39) splice site probably benign
IGL01761:C4b APN 17 34,958,912 (GRCm39) missense possibly damaging 0.56
IGL02004:C4b APN 17 34,957,984 (GRCm39) unclassified probably benign
IGL02215:C4b APN 17 34,953,465 (GRCm39) missense probably damaging 1.00
IGL02517:C4b APN 17 34,953,382 (GRCm39) missense probably benign 0.01
IGL02926:C4b APN 17 34,949,686 (GRCm39) missense possibly damaging 0.95
IGL03031:C4b APN 17 34,950,104 (GRCm39) missense possibly damaging 0.47
IGL03057:C4b APN 17 34,956,738 (GRCm39) unclassified probably benign
IGL03165:C4b APN 17 34,958,929 (GRCm39) missense probably benign 0.13
IGL03380:C4b APN 17 34,959,260 (GRCm39) missense probably benign 0.01
Aspiration UTSW 17 34,953,416 (GRCm39) missense probably benign 0.00
Inspiration UTSW 17 34,951,140 (GRCm39) splice site probably null
Peroration UTSW 17 34,948,373 (GRCm39) critical splice donor site probably null
perspiration UTSW 17 34,948,805 (GRCm39) missense probably damaging 1.00
FR4548:C4b UTSW 17 34,959,971 (GRCm39) missense probably benign 0.00
PIT4142001:C4b UTSW 17 34,952,675 (GRCm39) missense probably benign 0.01
R0064:C4b UTSW 17 34,957,830 (GRCm39) missense probably damaging 1.00
R0113:C4b UTSW 17 34,960,214 (GRCm39) missense probably damaging 0.98
R0143:C4b UTSW 17 34,953,193 (GRCm39) unclassified probably benign
R0254:C4b UTSW 17 34,953,750 (GRCm39) missense probably benign 0.00
R0320:C4b UTSW 17 34,952,135 (GRCm39) missense probably benign 0.01
R0391:C4b UTSW 17 34,954,588 (GRCm39) splice site probably benign
R0399:C4b UTSW 17 34,947,843 (GRCm39) missense probably damaging 1.00
R0467:C4b UTSW 17 34,955,101 (GRCm39) missense probably benign 0.01
R0549:C4b UTSW 17 34,954,389 (GRCm39) missense probably damaging 1.00
R0561:C4b UTSW 17 34,953,391 (GRCm39) missense probably damaging 0.99
R0941:C4b UTSW 17 34,959,029 (GRCm39) missense probably benign
R1161:C4b UTSW 17 34,948,567 (GRCm39) missense probably damaging 1.00
R1169:C4b UTSW 17 34,961,946 (GRCm39) missense probably benign 0.14
R1186:C4b UTSW 17 34,955,283 (GRCm39) missense possibly damaging 0.47
R1310:C4b UTSW 17 34,948,567 (GRCm39) missense probably damaging 1.00
R1398:C4b UTSW 17 34,949,693 (GRCm39) unclassified probably benign
R1472:C4b UTSW 17 34,962,743 (GRCm39) nonsense probably null
R1496:C4b UTSW 17 34,958,995 (GRCm39) missense probably benign 0.30
R1544:C4b UTSW 17 34,957,941 (GRCm39) missense probably benign 0.13
R1588:C4b UTSW 17 34,959,999 (GRCm39) missense probably benign
R1645:C4b UTSW 17 34,959,571 (GRCm39) missense probably damaging 1.00
R1664:C4b UTSW 17 34,951,952 (GRCm39) missense probably damaging 1.00
R1678:C4b UTSW 17 34,962,624 (GRCm39) missense probably benign 0.05
R1710:C4b UTSW 17 34,962,638 (GRCm39) splice site probably benign
R1713:C4b UTSW 17 34,948,245 (GRCm39) splice site probably benign
R1770:C4b UTSW 17 34,955,901 (GRCm39) missense possibly damaging 0.78
R1859:C4b UTSW 17 34,954,527 (GRCm39) missense probably benign
R1924:C4b UTSW 17 34,948,631 (GRCm39) missense probably damaging 1.00
R2057:C4b UTSW 17 34,947,594 (GRCm39) missense probably damaging 1.00
R2060:C4b UTSW 17 34,955,075 (GRCm39) missense probably damaging 1.00
R2184:C4b UTSW 17 34,956,676 (GRCm39) missense probably benign 0.27
R2306:C4b UTSW 17 34,947,492 (GRCm39) missense probably benign 0.00
R2363:C4b UTSW 17 34,955,032 (GRCm39) splice site probably benign
R2365:C4b UTSW 17 34,955,032 (GRCm39) splice site probably benign
R2379:C4b UTSW 17 34,954,717 (GRCm39) missense possibly damaging 0.81
R2860:C4b UTSW 17 34,953,732 (GRCm39) missense probably damaging 0.99
R2861:C4b UTSW 17 34,953,732 (GRCm39) missense probably damaging 0.99
R3551:C4b UTSW 17 34,960,846 (GRCm39) missense possibly damaging 0.75
R3765:C4b UTSW 17 34,948,814 (GRCm39) missense probably damaging 0.98
R4157:C4b UTSW 17 34,961,829 (GRCm39) missense probably damaging 1.00
R4299:C4b UTSW 17 34,950,118 (GRCm39) missense possibly damaging 0.52
R4365:C4b UTSW 17 34,953,717 (GRCm39) missense possibly damaging 0.65
R4411:C4b UTSW 17 34,947,838 (GRCm39) missense probably damaging 1.00
R4613:C4b UTSW 17 34,953,525 (GRCm39) missense probably benign 0.12
R4784:C4b UTSW 17 34,952,380 (GRCm39) missense probably benign 0.00
R4790:C4b UTSW 17 34,953,117 (GRCm39) missense probably benign 0.01
R4831:C4b UTSW 17 34,955,864 (GRCm39) splice site probably null
R4879:C4b UTSW 17 34,962,621 (GRCm39) missense probably damaging 0.99
R5036:C4b UTSW 17 34,959,419 (GRCm39) critical splice acceptor site probably null
R5361:C4b UTSW 17 34,960,212 (GRCm39) missense probably benign 0.15
R5384:C4b UTSW 17 34,956,635 (GRCm39) missense possibly damaging 0.89
R5518:C4b UTSW 17 34,953,416 (GRCm39) missense probably benign 0.00
R5590:C4b UTSW 17 34,959,309 (GRCm39) missense probably damaging 0.98
R5643:C4b UTSW 17 34,961,391 (GRCm39) missense probably benign 0.01
R5644:C4b UTSW 17 34,961,391 (GRCm39) missense probably benign 0.01
R5833:C4b UTSW 17 34,949,647 (GRCm39) missense probably damaging 1.00
R5931:C4b UTSW 17 34,948,167 (GRCm39) missense probably damaging 0.99
R6178:C4b UTSW 17 34,952,380 (GRCm39) missense probably benign 0.00
R6209:C4b UTSW 17 34,960,061 (GRCm39) missense possibly damaging 0.93
R6225:C4b UTSW 17 34,957,848 (GRCm39) missense possibly damaging 0.64
R6518:C4b UTSW 17 34,953,179 (GRCm39) missense probably damaging 0.98
R6613:C4b UTSW 17 34,952,539 (GRCm39) missense probably damaging 0.99
R6781:C4b UTSW 17 34,961,928 (GRCm39) missense probably damaging 0.99
R6807:C4b UTSW 17 34,949,930 (GRCm39) missense probably benign 0.17
R6858:C4b UTSW 17 34,948,805 (GRCm39) missense probably damaging 1.00
R6962:C4b UTSW 17 34,951,140 (GRCm39) splice site probably null
R7068:C4b UTSW 17 34,952,451 (GRCm39) missense probably damaging 1.00
R7081:C4b UTSW 17 34,954,417 (GRCm39) missense probably benign 0.27
R7105:C4b UTSW 17 34,949,885 (GRCm39) missense possibly damaging 0.52
R7211:C4b UTSW 17 34,954,508 (GRCm39) missense possibly damaging 0.92
R7296:C4b UTSW 17 34,962,633 (GRCm39) missense probably damaging 1.00
R7314:C4b UTSW 17 34,959,330 (GRCm39) missense probably benign
R7330:C4b UTSW 17 34,949,446 (GRCm39) missense probably damaging 1.00
R7397:C4b UTSW 17 34,961,364 (GRCm39) missense possibly damaging 0.80
R7437:C4b UTSW 17 34,953,707 (GRCm39) missense probably benign 0.10
R7490:C4b UTSW 17 34,950,054 (GRCm39) nonsense probably null
R7597:C4b UTSW 17 34,958,649 (GRCm39) missense probably benign
R7633:C4b UTSW 17 34,948,373 (GRCm39) critical splice donor site probably null
R7900:C4b UTSW 17 34,958,751 (GRCm39) missense probably benign 0.03
R7910:C4b UTSW 17 34,959,326 (GRCm39) missense probably benign 0.00
R7923:C4b UTSW 17 34,961,354 (GRCm39) missense probably damaging 1.00
R7960:C4b UTSW 17 34,960,252 (GRCm39) splice site probably null
R8420:C4b UTSW 17 34,953,513 (GRCm39) missense probably damaging 0.97
R8467:C4b UTSW 17 34,951,787 (GRCm39) missense possibly damaging 0.51
R8558:C4b UTSW 17 34,955,541 (GRCm39) missense probably damaging 1.00
R8725:C4b UTSW 17 34,953,459 (GRCm39) missense probably damaging 1.00
R8727:C4b UTSW 17 34,953,459 (GRCm39) missense probably damaging 1.00
R8853:C4b UTSW 17 34,948,879 (GRCm39) missense possibly damaging 0.91
R8934:C4b UTSW 17 34,951,958 (GRCm39) missense possibly damaging 0.78
R8944:C4b UTSW 17 34,961,913 (GRCm39) missense probably benign 0.00
R8960:C4b UTSW 17 34,952,892 (GRCm39) missense probably damaging 1.00
R8982:C4b UTSW 17 34,953,338 (GRCm39) critical splice donor site probably null
R9104:C4b UTSW 17 34,948,233 (GRCm39) missense probably benign 0.39
R9114:C4b UTSW 17 34,948,404 (GRCm39) missense probably damaging 0.99
R9348:C4b UTSW 17 34,952,159 (GRCm39) missense probably benign 0.01
R9428:C4b UTSW 17 34,949,885 (GRCm39) missense possibly damaging 0.52
R9533:C4b UTSW 17 34,956,698 (GRCm39) nonsense probably null
R9591:C4b UTSW 17 34,957,929 (GRCm39) missense probably benign 0.00
R9678:C4b UTSW 17 34,960,763 (GRCm39) critical splice donor site probably null
Z1176:C4b UTSW 17 34,950,121 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGATTCTCAGACTGTGCCACACCC -3'
(R):5'- TGACTGAGGCAGATCCTTCGTACC -3'

Sequencing Primer
(F):5'- CCACACCCCGCCTCTTC -3'
(R):5'- ATACGCATGTAAGCCCTGG -3'
Posted On 2013-07-30