Incidental Mutation 'R8054:Brca2'
ID619250
Institutional Source Beutler Lab
Gene Symbol Brca2
Ensembl Gene ENSMUSG00000041147
Gene Namebreast cancer 2, early onset
SynonymsFancd1, RAB163
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8054 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location150522630-150570329 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 150536504 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 415 (I415V)
Ref Sequence ENSEMBL: ENSMUSP00000144676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044620] [ENSMUST00000202003] [ENSMUST00000202313]
Predicted Effect probably benign
Transcript: ENSMUST00000044620
AA Change: I415V

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000038576
Gene: ENSMUSG00000041147
AA Change: I415V

DomainStartEndE-ValueType
low complexity region 36 51 N/A INTRINSIC
low complexity region 100 123 N/A INTRINSIC
low complexity region 187 199 N/A INTRINSIC
low complexity region 746 761 N/A INTRINSIC
low complexity region 904 917 N/A INTRINSIC
Pfam:BRCA2 982 1014 2.6e-13 PFAM
Pfam:BRCA2 1193 1225 3.9e-16 PFAM
low complexity region 1239 1252 N/A INTRINSIC
Pfam:BRCA2 1395 1425 1.4e-13 PFAM
Pfam:BRCA2 1492 1524 1.8e-13 PFAM
Pfam:BRCA2 1624 1655 8.4e-12 PFAM
Pfam:BRCA2 1925 1957 8e-15 PFAM
Pfam:BRCA2 2005 2037 1.7e-11 PFAM
Pfam:BRCA-2_helical 2402 2588 1.3e-94 PFAM
Pfam:BRCA-2_OB1 2591 2717 5.3e-44 PFAM
Tower 2752 2793 2.37e-18 SMART
Pfam:BRCA-2_OB3 2971 3104 1.5e-49 PFAM
low complexity region 3197 3208 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202003
AA Change: I415V

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000144676
Gene: ENSMUSG00000041147
AA Change: I415V

DomainStartEndE-ValueType
low complexity region 36 51 N/A INTRINSIC
low complexity region 100 123 N/A INTRINSIC
low complexity region 187 199 N/A INTRINSIC
low complexity region 746 761 N/A INTRINSIC
low complexity region 904 917 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202313
AA Change: I415V

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000144150
Gene: ENSMUSG00000041147
AA Change: I415V

DomainStartEndE-ValueType
low complexity region 36 51 N/A INTRINSIC
low complexity region 100 123 N/A INTRINSIC
low complexity region 187 199 N/A INTRINSIC
low complexity region 746 761 N/A INTRINSIC
low complexity region 904 917 N/A INTRINSIC
Pfam:BRCA2 982 1014 2.6e-13 PFAM
Pfam:BRCA2 1193 1225 3.9e-16 PFAM
low complexity region 1239 1252 N/A INTRINSIC
Pfam:BRCA2 1395 1425 1.4e-13 PFAM
Pfam:BRCA2 1492 1524 1.8e-13 PFAM
Pfam:BRCA2 1624 1655 8.4e-12 PFAM
Pfam:BRCA2 1925 1957 8e-15 PFAM
Pfam:BRCA2 2005 2037 1.7e-11 PFAM
Pfam:BRCA-2_helical 2402 2588 1.3e-94 PFAM
Pfam:BRCA-2_OB1 2591 2717 5.3e-44 PFAM
Tower 2752 2793 2.37e-18 SMART
Pfam:BRCA-2_OB3 2971 3104 1.5e-49 PFAM
low complexity region 3197 3208 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Inherited mutations in BRCA1 and this gene, BRCA2, confer increased lifetime risk of developing breast or ovarian cancer. Both BRCA1 and BRCA2 are involved in maintenance of genome stability, specifically the homologous recombination pathway for double-strand DNA repair. The BRCA2 protein contains several copies of a 70 aa motif called the BRC motif, and these motifs mediate binding to the RAD51 recombinase which functions in DNA repair. BRCA2 is considered a tumor suppressor gene, as tumors with BRCA2 mutations generally exhibit loss of heterozygosity (LOH) of the wild-type allele. [provided by RefSeq, Dec 2008]
PHENOTYPE: Homozygous null mutants are embryonic lethal with abnormalities including growth retardation, neural tube defects, and mesoderm abnormalities; conditional mutations cause genetic instability and enhanced tumor formation; mutants with truncated BRCA2 protein survive, are small, infertile, show improper tissue differentiation and develop lymphomas and carcinomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b A G 5: 8,824,272 N399S probably benign Het
Akap9 T C 5: 4,038,707 probably null Het
Ankrd17 A G 5: 90,291,055 I483T probably benign Het
Arl13b T C 16: 62,806,597 D247G probably benign Het
Brpf3 C A 17: 28,836,597 S1173R probably damaging Het
Ccar1 A G 10: 62,747,436 L966P unknown Het
Ccdc129 A T 6: 55,976,439 K913N probably damaging Het
Cfap61 A G 2: 145,973,518 N249S probably damaging Het
Clip4 T A 17: 71,834,273 Y541N possibly damaging Het
Csn2 C T 5: 87,698,027 probably null Het
Cyp2c23 T G 19: 44,007,116 E404A probably damaging Het
Cyp2e1 A G 7: 140,770,958 E281G possibly damaging Het
Cyp2r1 T A 7: 114,552,084 probably null Het
D430041D05Rik T A 2: 104,155,045 I1226F possibly damaging Het
Dbx1 A T 7: 49,632,750 W236R probably damaging Het
Dcp2 T G 18: 44,405,707 N251K probably benign Het
Disp1 A T 1: 183,088,248 Y869* probably null Het
Dnajc8 T A 4: 132,544,757 probably benign Het
Ehhadh A G 16: 21,773,493 probably null Het
Eml3 A T 19: 8,939,050 T670S possibly damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fbn1 A T 2: 125,346,018 D1530E possibly damaging Het
Gm11639 A G 11: 104,730,400 N822D probably benign Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Hsd3b3 A T 3: 98,742,015 Y331N probably damaging Het
Ino80d T C 1: 63,058,678 R791G possibly damaging Het
Jade2 T C 11: 51,818,614 R523G probably benign Het
Kmt2d A T 15: 98,843,925 D4451E unknown Het
Lax1 T C 1: 133,683,607 T76A probably benign Het
Map4k1 A G 7: 28,989,756 probably benign Het
Mcu G A 10: 59,454,995 T121M probably damaging Het
Mepce T A 5: 137,784,742 K441* probably null Het
Mettl21e C A 1: 44,206,655 V144F probably damaging Het
Muc6 T A 7: 141,645,481 S1049C probably damaging Het
Myh14 C T 7: 44,625,127 V1246M probably damaging Het
Myo3a A T 2: 22,574,317 Q1128L probably benign Het
Nat8f2 T C 6: 85,867,772 S203G probably benign Het
Npas2 A G 1: 39,287,571 T46A possibly damaging Het
Nup133 T C 8: 123,949,217 probably benign Het
Olfr11 A T 13: 21,638,949 D191E probably benign Het
Olfr1375 T A 11: 51,048,263 I52N probably benign Het
Olfr213 A G 6: 116,540,999 H182R probably damaging Het
Olfr44 C A 9: 39,484,737 C172F probably damaging Het
Olfr998 A T 2: 85,590,840 Q100L probably damaging Het
Oplah C T 15: 76,306,257 R102H probably benign Het
Osgep C T 14: 50,924,671 probably benign Het
Pam A T 1: 97,840,389 D705E probably damaging Het
Papd5 T A 8: 88,247,558 I294N probably damaging Het
Pkd1l3 C G 8: 109,646,376 N1284K probably damaging Het
Plekhg2 A G 7: 28,365,316 F407S probably damaging Het
Pygl A G 12: 70,227,339 probably null Het
Rcc2 G A 4: 140,702,275 C40Y probably benign Het
Rhobtb1 A G 10: 69,248,890 N37S probably damaging Het
Sema6a T A 18: 47,291,905 D213V probably damaging Het
Skint11 A T 4: 114,244,609 Q273L possibly damaging Het
Skint7 A T 4: 111,982,229 H240L probably benign Het
Slc12a2 C T 18: 57,921,872 Q862* probably null Het
Smox A G 2: 131,522,180 S468G probably benign Het
Spc25 A G 2: 69,204,913 S50P probably damaging Het
Spert A G 14: 75,583,899 Y129H probably benign Het
Srrm1 A T 4: 135,325,015 S683T unknown Het
Syne1 T C 10: 5,270,970 E3103G probably benign Het
Tenm4 C A 7: 96,729,346 probably benign Het
Tmem123 T C 9: 7,791,063 S122P possibly damaging Het
Trav18 A T 14: 53,831,115 K4I probably benign Het
Triml1 T C 8: 43,130,383 S394G probably damaging Het
Ubr4 A T 4: 139,468,102 S1212C unknown Het
Usp34 G A 11: 23,361,295 R442Q Het
Usp43 G A 11: 67,891,458 P378L probably damaging Het
Vmn1r212 A G 13: 22,883,765 F133L probably benign Het
Vmn1r213 A G 13: 23,011,740 I164M possibly damaging Het
Vmn2r19 C T 6: 123,316,039 P347S probably damaging Het
Zfp106 A T 2: 120,524,519 V1280E possibly damaging Het
Zfp317 T C 9: 19,641,969 S13P probably benign Het
Zfp608 C A 18: 54,899,546 A441S probably benign Het
Zufsp T C 10: 33,940,252 D232G probably damaging Het
Other mutations in Brca2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Brca2 APN 5 150539898 missense probably benign 0.18
IGL00392:Brca2 APN 5 150541240 missense probably benign 0.02
IGL00557:Brca2 APN 5 150560538 missense probably benign
IGL00798:Brca2 APN 5 150539463 missense probably benign 0.30
IGL00933:Brca2 APN 5 150542404 missense probably benign 0.04
IGL00964:Brca2 APN 5 150532310 missense probably damaging 1.00
IGL01152:Brca2 APN 5 150542390 missense probably damaging 0.99
IGL01577:Brca2 APN 5 150541620 nonsense probably null
IGL01585:Brca2 APN 5 150539516 missense possibly damaging 0.76
IGL01732:Brca2 APN 5 150542387 missense probably benign 0.13
IGL01809:Brca2 APN 5 150531061 splice site probably null
IGL01911:Brca2 APN 5 150567613 missense probably damaging 0.96
IGL02113:Brca2 APN 5 150540979 missense possibly damaging 0.95
IGL02313:Brca2 APN 5 150538661 missense probably damaging 1.00
IGL02342:Brca2 APN 5 150542824 missense possibly damaging 0.94
IGL02508:Brca2 APN 5 150543308 missense possibly damaging 0.85
IGL02532:Brca2 APN 5 150550862 missense probably damaging 1.00
IGL02646:Brca2 APN 5 150560790 missense possibly damaging 0.89
IGL02738:Brca2 APN 5 150567035 missense probably damaging 1.00
IGL02833:Brca2 APN 5 150541790 missense possibly damaging 0.83
IGL02871:Brca2 APN 5 150542552 missense probably benign 0.13
IGL02995:Brca2 APN 5 150529488 missense probably damaging 1.00
IGL03105:Brca2 APN 5 150560485 missense probably benign 0.02
BB007:Brca2 UTSW 5 150558510 missense probably damaging 0.96
BB017:Brca2 UTSW 5 150558510 missense probably damaging 0.96
R0219:Brca2 UTSW 5 150523175 splice site probably benign
R0416:Brca2 UTSW 5 150569392 missense possibly damaging 0.93
R0441:Brca2 UTSW 5 150541857 missense probably damaging 0.96
R0548:Brca2 UTSW 5 150544935 missense probably damaging 0.96
R0745:Brca2 UTSW 5 150544882 splice site probably benign
R0799:Brca2 UTSW 5 150560193 missense probably damaging 0.99
R1165:Brca2 UTSW 5 150542747 missense probably damaging 0.98
R1247:Brca2 UTSW 5 150541274 missense probably damaging 1.00
R1403:Brca2 UTSW 5 150542649 missense probably benign 0.22
R1403:Brca2 UTSW 5 150542649 missense probably benign 0.22
R1444:Brca2 UTSW 5 150542450 missense probably benign
R1466:Brca2 UTSW 5 150552258 missense probably damaging 0.99
R1466:Brca2 UTSW 5 150552258 missense probably damaging 0.99
R1584:Brca2 UTSW 5 150552258 missense probably damaging 0.99
R1599:Brca2 UTSW 5 150548713 nonsense probably null
R1600:Brca2 UTSW 5 150560830 splice site probably benign
R1822:Brca2 UTSW 5 150540198 missense probably benign 0.06
R1824:Brca2 UTSW 5 150536922 missense possibly damaging 0.94
R2037:Brca2 UTSW 5 150540669 missense probably benign
R2131:Brca2 UTSW 5 150557129 missense probably damaging 1.00
R2203:Brca2 UTSW 5 150539502 missense possibly damaging 0.58
R2208:Brca2 UTSW 5 150532344 missense probably damaging 0.96
R2293:Brca2 UTSW 5 150560534 missense possibly damaging 0.86
R2517:Brca2 UTSW 5 150539672 missense probably benign 0.04
R2566:Brca2 UTSW 5 150541762 missense probably benign 0.03
R3422:Brca2 UTSW 5 150543121 missense possibly damaging 0.91
R3917:Brca2 UTSW 5 150540827 missense probably damaging 0.96
R3946:Brca2 UTSW 5 150536704 missense probably damaging 0.96
R4176:Brca2 UTSW 5 150539633 nonsense probably null
R4255:Brca2 UTSW 5 150541169 missense possibly damaging 0.92
R4450:Brca2 UTSW 5 150536053 missense probably damaging 0.96
R4603:Brca2 UTSW 5 150536165 missense possibly damaging 0.86
R4681:Brca2 UTSW 5 150552398 splice site probably null
R4755:Brca2 UTSW 5 150559987 splice site probably null
R4762:Brca2 UTSW 5 150531116 missense probably benign 0.00
R4824:Brca2 UTSW 5 150539735 missense probably damaging 1.00
R4887:Brca2 UTSW 5 150556937 missense probably damaging 1.00
R5020:Brca2 UTSW 5 150560436 missense probably damaging 1.00
R5159:Brca2 UTSW 5 150542108 missense possibly damaging 0.93
R5216:Brca2 UTSW 5 150542980 missense probably damaging 0.99
R5269:Brca2 UTSW 5 150539223 missense possibly damaging 0.75
R5274:Brca2 UTSW 5 150539689 missense probably benign 0.00
R5589:Brca2 UTSW 5 150557132 missense possibly damaging 0.67
R5619:Brca2 UTSW 5 150557114 missense probably damaging 0.96
R5641:Brca2 UTSW 5 150556899 missense probably damaging 1.00
R5686:Brca2 UTSW 5 150540904 missense probably benign 0.00
R5730:Brca2 UTSW 5 150569005 missense possibly damaging 0.85
R5763:Brca2 UTSW 5 150548006 missense possibly damaging 0.85
R5877:Brca2 UTSW 5 150543221 missense possibly damaging 0.53
R5893:Brca2 UTSW 5 150569138 missense probably benign 0.02
R5900:Brca2 UTSW 5 150541132 missense probably benign 0.01
R5926:Brca2 UTSW 5 150534622 missense probably benign 0.07
R5966:Brca2 UTSW 5 150543251 missense probably damaging 0.99
R6025:Brca2 UTSW 5 150541575 frame shift probably null
R6062:Brca2 UTSW 5 150556889 missense probably damaging 0.96
R6141:Brca2 UTSW 5 150540637 missense possibly damaging 0.91
R6244:Brca2 UTSW 5 150566978 missense probably benign 0.08
R6508:Brca2 UTSW 5 150536593 missense possibly damaging 0.91
R6519:Brca2 UTSW 5 150540979 missense probably damaging 0.99
R6611:Brca2 UTSW 5 150536193 missense probably damaging 0.99
R6698:Brca2 UTSW 5 150532394 missense probably damaging 1.00
R6856:Brca2 UTSW 5 150540208 missense possibly damaging 0.68
R6912:Brca2 UTSW 5 150541742 missense probably damaging 0.99
R7002:Brca2 UTSW 5 150539918 missense probably benign
R7025:Brca2 UTSW 5 150540478 missense probably benign 0.39
R7151:Brca2 UTSW 5 150541436 missense probably benign 0.12
R7202:Brca2 UTSW 5 150532354 missense probably benign 0.03
R7365:Brca2 UTSW 5 150532337 missense probably damaging 0.99
R7510:Brca2 UTSW 5 150536691 missense possibly damaging 0.85
R7612:Brca2 UTSW 5 150540611 missense probably benign 0.03
R7682:Brca2 UTSW 5 150543153 missense probably benign
R7890:Brca2 UTSW 5 150539381 missense possibly damaging 0.83
R7930:Brca2 UTSW 5 150558510 missense probably damaging 0.96
R7940:Brca2 UTSW 5 150538733 missense probably benign
R8056:Brca2 UTSW 5 150569306 missense possibly damaging 0.85
R8080:Brca2 UTSW 5 150539892 missense probably benign 0.11
R8094:Brca2 UTSW 5 150536169 missense possibly damaging 0.85
R8306:Brca2 UTSW 5 150536663 missense possibly damaging 0.91
R8401:Brca2 UTSW 5 150552352 missense probably damaging 1.00
R8523:Brca2 UTSW 5 150560148 missense possibly damaging 0.75
R8784:Brca2 UTSW 5 150548661 nonsense probably null
R8791:Brca2 UTSW 5 150542596 missense possibly damaging 0.92
R8832:Brca2 UTSW 5 150542146 missense possibly damaging 0.91
R8838:Brca2 UTSW 5 150541540 missense possibly damaging 0.91
R8845:Brca2 UTSW 5 150543382 missense possibly damaging 0.85
R8898:Brca2 UTSW 5 150569033 missense possibly damaging 0.53
R8914:Brca2 UTSW 5 150541743 missense probably damaging 0.96
Z1088:Brca2 UTSW 5 150542763 missense probably damaging 0.96
Z1186:Brca2 UTSW 5 150536583 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTAGATCCAGGTGTAACAAGCCAG -3'
(R):5'- CCTGATACTCGGAGAAAGACAG -3'

Sequencing Primer
(F):5'- GAAGCCCTTTTACAGCCAGAATGAG -3'
(R):5'- AAAGACAGGCTGCTTGACTTGTTC -3'
Posted On2020-01-23