Mutagenetix > Incidental Mutation

Incidental Mutation 'R8054:Nup133'

619266

Institutional Source

Beutler Lab

Gene Symbol

Nup133

Ensembl Gene

ENSMUSG00000039509

Gene Name

nucleoporin 133

Synonyms

mermaid, 4832420O05Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8054 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

123897123-123949265 bp(-) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

T to C at 123949217 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000118564 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044795] [ENSMUST00000075578] [ENSMUST00000127664]

AlphaFold

Q8R0G9

Predicted Effect

probably benign
Transcript: ENSMUST00000044795

SMART Domains

Protein: ENSMUSP00000048084
Gene: ENSMUSG00000039509

Domain	Start	End	E-Value	Type
low complexity region	8	19	N/A	INTRINSIC
PDB:1XKS\|A	66	513	N/A	PDB
Pfam:Nucleoporin_C	593	1052	1.2e-26	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000075578

SMART Domains

Protein: ENSMUSP00000075011
Gene: ENSMUSG00000031974

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	136	407	1.7e-60	PFAM
AAA	484	675	1.68e-18	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000127664

SMART Domains

Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

Domain	Start	End	E-Value	Type
Pfam:Glycos_transf_2	104	287	7.4e-31	PFAM
Pfam:Glyco_transf_7C	261	331	4.9e-8	PFAM
RICIN	406	531	9.28e-27	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

100% (75/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear envelope creates distinct nuclear and cytoplasmic compartments in eukaryotic cells. It consists of two concentric membranes perforated by nuclear pores, large protein complexes that form aqueous channels to regulate the flow of macromolecules between the nucleus and the cytoplasm. These complexes are composed of at least 100 different polypeptide subunits, many of which belong to the nucleoporin family. The nucleoporin protein encoded by this gene displays evolutionarily conserved interactions with other nucleoporins. This protein, which localizes to both sides of the nuclear pore complex at interphase, remains associated with the complex during mitosis and is targeted at early stages to the reforming nuclear envelope. This protein also localizes to kinetochores of mitotic cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit embryonic lethality prior to E10.5, abnormal somitogenesis, pericardial edema, growth retardation, and abnormal neural development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb1b	A	G	5: 8,824,272	N399S	probably benign	Het
Akap9	T	C	5: 4,038,707		probably null	Het
Ankrd17	A	G	5: 90,291,055	I483T	probably benign	Het
Arl13b	T	C	16: 62,806,597	D247G	probably benign	Het
Brca2	A	G	5: 150,536,504	I415V	probably benign	Het
Brpf3	C	A	17: 28,836,597	S1173R	probably damaging	Het
Ccar1	A	G	10: 62,747,436	L966P	unknown	Het
Ccdc129	A	T	6: 55,976,439	K913N	probably damaging	Het
Cfap61	A	G	2: 145,973,518	N249S	probably damaging	Het
Clip4	T	A	17: 71,834,273	Y541N	possibly damaging	Het
Csn2	C	T	5: 87,698,027		probably null	Het
Cyp2c23	T	G	19: 44,007,116	E404A	probably damaging	Het
Cyp2e1	A	G	7: 140,770,958	E281G	possibly damaging	Het
Cyp2r1	T	A	7: 114,552,084		probably null	Het
D430041D05Rik	T	A	2: 104,155,045	I1226F	possibly damaging	Het
Dbx1	A	T	7: 49,632,750	W236R	probably damaging	Het
Dcp2	T	G	18: 44,405,707	N251K	probably benign	Het
Disp1	A	T	1: 183,088,248	Y869*	probably null	Het
Dnajc8	T	A	4: 132,544,757		probably benign	Het
Ehhadh	A	G	16: 21,773,493		probably null	Het
Eml3	A	T	19: 8,939,050	T670S	possibly damaging	Het
Fan1	T	A	7: 64,372,486	N340Y	probably damaging	Het
Fbn1	A	T	2: 125,346,018	D1530E	possibly damaging	Het
Gm11639	A	G	11: 104,730,400	N822D	probably benign	Het
Gm40460	CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG	CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG	7: 142,240,817		probably benign	Het
Hsd3b3	A	T	3: 98,742,015	Y331N	probably damaging	Het
Ino80d	T	C	1: 63,058,678	R791G	possibly damaging	Het
Jade2	T	C	11: 51,818,614	R523G	probably benign	Het
Kmt2d	A	T	15: 98,843,925	D4451E	unknown	Het
Lax1	T	C	1: 133,683,607	T76A	probably benign	Het
Map4k1	A	G	7: 28,989,756		probably benign	Het
Mcu	G	A	10: 59,454,995	T121M	probably damaging	Het
Mepce	T	A	5: 137,784,742	K441*	probably null	Het
Mettl21e	C	A	1: 44,206,655	V144F	probably damaging	Het
Muc6	T	A	7: 141,645,481	S1049C	probably damaging	Het
Myh14	C	T	7: 44,625,127	V1246M	probably damaging	Het
Myo3a	A	T	2: 22,574,317	Q1128L	probably benign	Het
Nat8f2	T	C	6: 85,867,772	S203G	probably benign	Het
Npas2	A	G	1: 39,287,571	T46A	possibly damaging	Het
Olfr11	A	T	13: 21,638,949	D191E	probably benign	Het
Olfr1375	T	A	11: 51,048,263	I52N	probably benign	Het
Olfr213	A	G	6: 116,540,999	H182R	probably damaging	Het
Olfr44	C	A	9: 39,484,737	C172F	probably damaging	Het
Olfr998	A	T	2: 85,590,840	Q100L	probably damaging	Het
Oplah	C	T	15: 76,306,257	R102H	probably benign	Het
Osgep	C	T	14: 50,924,671		probably benign	Het
Pam	A	T	1: 97,840,389	D705E	probably damaging	Het
Papd5	T	A	8: 88,247,558	I294N	probably damaging	Het
Pkd1l3	C	G	8: 109,646,376	N1284K	probably damaging	Het
Plekhg2	A	G	7: 28,365,316	F407S	probably damaging	Het
Pygl	A	G	12: 70,227,339		probably null	Het
Rcc2	G	A	4: 140,702,275	C40Y	probably benign	Het
Rhobtb1	A	G	10: 69,248,890	N37S	probably damaging	Het
Sema6a	T	A	18: 47,291,905	D213V	probably damaging	Het
Skint11	A	T	4: 114,244,609	Q273L	possibly damaging	Het
Skint7	A	T	4: 111,982,229	H240L	probably benign	Het
Slc12a2	C	T	18: 57,921,872	Q862*	probably null	Het
Smox	A	G	2: 131,522,180	S468G	probably benign	Het
Spc25	A	G	2: 69,204,913	S50P	probably damaging	Het
Spert	A	G	14: 75,583,899	Y129H	probably benign	Het
Srrm1	A	T	4: 135,325,015	S683T	unknown	Het
Syne1	T	C	10: 5,270,970	E3103G	probably benign	Het
Tenm4	C	A	7: 96,729,346		probably benign	Het
Tmem123	T	C	9: 7,791,063	S122P	possibly damaging	Het
Trav18	A	T	14: 53,831,115	K4I	probably benign	Het
Triml1	T	C	8: 43,130,383	S394G	probably damaging	Het
Ubr4	A	T	4: 139,468,102	S1212C	unknown	Het
Usp34	G	A	11: 23,361,295	R442Q		Het
Usp43	G	A	11: 67,891,458	P378L	probably damaging	Het
Vmn1r212	A	G	13: 22,883,765	F133L	probably benign	Het
Vmn1r213	A	G	13: 23,011,740	I164M	possibly damaging	Het
Vmn2r19	C	T	6: 123,316,039	P347S	probably damaging	Het
Zfp106	A	T	2: 120,524,519	V1280E	possibly damaging	Het
Zfp317	T	C	9: 19,641,969	S13P	probably benign	Het
Zfp608	C	A	18: 54,899,546	A441S	probably benign	Het
Zufsp	T	C	10: 33,940,252	D232G	probably damaging	Het

Other mutations in Nup133

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00470:Nup133	APN	8	123939083	missense	probably damaging	0.98
IGL00507:Nup133	APN	8	123918967	nonsense	probably null
IGL00585:Nup133	APN	8	123909994	missense	probably damaging	1.00
IGL00676:Nup133	APN	8	123906298	intron	probably benign
IGL00966:Nup133	APN	8	123911906	missense	probably damaging	0.98
IGL01069:Nup133	APN	8	123930982	nonsense	probably null
IGL01553:Nup133	APN	8	123915324	missense	possibly damaging	0.58
IGL01669:Nup133	APN	8	123939130	nonsense	probably null
IGL01730:Nup133	APN	8	123938233	missense	probably benign	0.00
IGL01996:Nup133	APN	8	123946595	missense	probably benign	0.00
IGL02332:Nup133	APN	8	123907832	missense	probably damaging	1.00
IGL02552:Nup133	APN	8	123929255	missense	possibly damaging	0.75
IGL02956:Nup133	APN	8	123949083	missense	probably benign	0.00
IGL03009:Nup133	APN	8	123933500	missense	possibly damaging	0.46
IGL03036:Nup133	APN	8	123946594	missense	probably benign	0.11
Cadenza	UTSW	8	123911888	frame shift	probably null
Gangen	UTSW	8	123916282	critical splice donor site	probably null
hochzeit	UTSW	8	123929343	missense	probably benign	0.00
low_road	UTSW	8	123904579	missense	probably damaging	1.00
Pathway	UTSW	8	123917446	missense	possibly damaging	0.82
Slant	UTSW	8	123916281	splice site	probably null
R0010:Nup133	UTSW	8	123904579	missense	probably damaging	1.00
R0010:Nup133	UTSW	8	123904579	missense	probably damaging	1.00
R0139:Nup133	UTSW	8	123929343	missense	probably benign	0.00
R0344:Nup133	UTSW	8	123917446	missense	possibly damaging	0.82
R0730:Nup133	UTSW	8	123949008	missense	probably benign	0.00
R1301:Nup133	UTSW	8	123917417	intron	probably benign
R1453:Nup133	UTSW	8	123915375	missense	probably benign	0.00
R1570:Nup133	UTSW	8	123949176	start codon destroyed	possibly damaging	0.82
R1607:Nup133	UTSW	8	123949035	missense	probably benign	0.02
R1773:Nup133	UTSW	8	123930983	nonsense	probably null
R1992:Nup133	UTSW	8	123906221	missense	possibly damaging	0.80
R2062:Nup133	UTSW	8	123914575	missense	probably damaging	1.00
R2065:Nup133	UTSW	8	123914575	missense	probably damaging	1.00
R2066:Nup133	UTSW	8	123914575	missense	probably damaging	1.00
R2068:Nup133	UTSW	8	123914575	missense	probably damaging	1.00
R4397:Nup133	UTSW	8	123944301	missense	probably benign	0.04
R4683:Nup133	UTSW	8	123930982	nonsense	probably null
R4771:Nup133	UTSW	8	123929398	missense	probably damaging	1.00
R4910:Nup133	UTSW	8	123927131	missense	possibly damaging	0.91
R4911:Nup133	UTSW	8	123927131	missense	possibly damaging	0.91
R4968:Nup133	UTSW	8	123915196	missense	probably benign	0.07
R5411:Nup133	UTSW	8	123927206	missense	probably benign
R5470:Nup133	UTSW	8	123930966	missense	probably benign	0.00
R5664:Nup133	UTSW	8	123906281	missense	probably benign	0.01
R5907:Nup133	UTSW	8	123916299	missense	possibly damaging	0.90
R6003:Nup133	UTSW	8	123938292	missense	probably damaging	0.98
R6059:Nup133	UTSW	8	123914596	missense	probably damaging	1.00
R6219:Nup133	UTSW	8	123936873	missense	possibly damaging	0.90
R6292:Nup133	UTSW	8	123917437	missense	probably benign	0.01
R6672:Nup133	UTSW	8	123916281	splice site	probably null
R6737:Nup133	UTSW	8	123906291	missense	probably damaging	0.99
R6763:Nup133	UTSW	8	123944278	missense	possibly damaging	0.95
R6870:Nup133	UTSW	8	123899507	missense	probably benign	0.08
R6975:Nup133	UTSW	8	123915318	missense	probably damaging	0.99
R7101:Nup133	UTSW	8	123906227	missense	possibly damaging	0.89
R7114:Nup133	UTSW	8	123915373	missense	probably benign	0.00
R7271:Nup133	UTSW	8	123922414	missense	probably benign	0.34
R7501:Nup133	UTSW	8	123922414	missense	probably benign	0.34
R8397:Nup133	UTSW	8	123922417	missense	probably benign	0.17
R8703:Nup133	UTSW	8	123916282	critical splice donor site	probably null
R8811:Nup133	UTSW	8	123911888	frame shift	probably null
R8813:Nup133	UTSW	8	123911888	frame shift	probably null
R8952:Nup133	UTSW	8	123907761	missense	probably damaging	1.00
R9116:Nup133	UTSW	8	123933416	missense	probably benign	0.00
R9340:Nup133	UTSW	8	123938142	missense	probably benign	0.38
X0023:Nup133	UTSW	8	123909988	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TACTTTCGAACTCTGCGGC -3'
(R):5'- TGACGTCAACAAAGCGCTCC -3'

Sequencing Primer
(F):5'- AACTCTGCGGCAGCTTAC -3'
(R):5'- AAAGCGCTCCCAGTTCCG -3'

Posted On

2020-01-23