Incidental Mutation 'R8054:Olfr44'
ID619269
Institutional Source Beutler Lab
Gene Symbol Olfr44
Ensembl Gene ENSMUSG00000062649
Gene Nameolfactory receptor 44
SynonymsGA_x6K02T2PVTD-33181773-33180838, MOR171-5, IB3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R8054 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location39481786-39493995 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 39484737 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 172 (C172F)
Ref Sequence ENSEMBL: ENSMUSP00000076935 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077757] [ENSMUST00000215065] [ENSMUST00000216316]
Predicted Effect probably damaging
Transcript: ENSMUST00000077757
AA Change: C172F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076935
Gene: ENSMUSG00000062649
AA Change: C172F

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 4.1e-50 PFAM
Pfam:7tm_1 44 293 1.7e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215065
AA Change: C169F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000216316
AA Change: C169F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b A G 5: 8,824,272 N399S probably benign Het
Akap9 T C 5: 4,038,707 probably null Het
Ankrd17 A G 5: 90,291,055 I483T probably benign Het
Arl13b T C 16: 62,806,597 D247G probably benign Het
Brca2 A G 5: 150,536,504 I415V probably benign Het
Brpf3 C A 17: 28,836,597 S1173R probably damaging Het
Ccar1 A G 10: 62,747,436 L966P unknown Het
Ccdc129 A T 6: 55,976,439 K913N probably damaging Het
Cfap61 A G 2: 145,973,518 N249S probably damaging Het
Clip4 T A 17: 71,834,273 Y541N possibly damaging Het
Csn2 C T 5: 87,698,027 probably null Het
Cyp2c23 T G 19: 44,007,116 E404A probably damaging Het
Cyp2e1 A G 7: 140,770,958 E281G possibly damaging Het
Cyp2r1 T A 7: 114,552,084 probably null Het
D430041D05Rik T A 2: 104,155,045 I1226F possibly damaging Het
Dbx1 A T 7: 49,632,750 W236R probably damaging Het
Dcp2 T G 18: 44,405,707 N251K probably benign Het
Disp1 A T 1: 183,088,248 Y869* probably null Het
Dnajc8 T A 4: 132,544,757 probably benign Het
Ehhadh A G 16: 21,773,493 probably null Het
Eml3 A T 19: 8,939,050 T670S possibly damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fbn1 A T 2: 125,346,018 D1530E possibly damaging Het
Gm11639 A G 11: 104,730,400 N822D probably benign Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Hsd3b3 A T 3: 98,742,015 Y331N probably damaging Het
Ino80d T C 1: 63,058,678 R791G possibly damaging Het
Jade2 T C 11: 51,818,614 R523G probably benign Het
Kmt2d A T 15: 98,843,925 D4451E unknown Het
Lax1 T C 1: 133,683,607 T76A probably benign Het
Map4k1 A G 7: 28,989,756 probably benign Het
Mcu G A 10: 59,454,995 T121M probably damaging Het
Mepce T A 5: 137,784,742 K441* probably null Het
Mettl21e C A 1: 44,206,655 V144F probably damaging Het
Muc6 T A 7: 141,645,481 S1049C probably damaging Het
Myh14 C T 7: 44,625,127 V1246M probably damaging Het
Myo3a A T 2: 22,574,317 Q1128L probably benign Het
Nat8f2 T C 6: 85,867,772 S203G probably benign Het
Npas2 A G 1: 39,287,571 T46A possibly damaging Het
Nup133 T C 8: 123,949,217 probably benign Het
Olfr11 A T 13: 21,638,949 D191E probably benign Het
Olfr1375 T A 11: 51,048,263 I52N probably benign Het
Olfr213 A G 6: 116,540,999 H182R probably damaging Het
Olfr998 A T 2: 85,590,840 Q100L probably damaging Het
Oplah C T 15: 76,306,257 R102H probably benign Het
Osgep C T 14: 50,924,671 probably benign Het
Pam A T 1: 97,840,389 D705E probably damaging Het
Papd5 T A 8: 88,247,558 I294N probably damaging Het
Pkd1l3 C G 8: 109,646,376 N1284K probably damaging Het
Plekhg2 A G 7: 28,365,316 F407S probably damaging Het
Pygl A G 12: 70,227,339 probably null Het
Rcc2 G A 4: 140,702,275 C40Y probably benign Het
Rhobtb1 A G 10: 69,248,890 N37S probably damaging Het
Sema6a T A 18: 47,291,905 D213V probably damaging Het
Skint11 A T 4: 114,244,609 Q273L possibly damaging Het
Skint7 A T 4: 111,982,229 H240L probably benign Het
Slc12a2 C T 18: 57,921,872 Q862* probably null Het
Smox A G 2: 131,522,180 S468G probably benign Het
Spc25 A G 2: 69,204,913 S50P probably damaging Het
Spert A G 14: 75,583,899 Y129H probably benign Het
Srrm1 A T 4: 135,325,015 S683T unknown Het
Syne1 T C 10: 5,270,970 E3103G probably benign Het
Tenm4 C A 7: 96,729,346 probably benign Het
Tmem123 T C 9: 7,791,063 S122P possibly damaging Het
Trav18 A T 14: 53,831,115 K4I probably benign Het
Triml1 T C 8: 43,130,383 S394G probably damaging Het
Ubr4 A T 4: 139,468,102 S1212C unknown Het
Usp34 G A 11: 23,361,295 R442Q Het
Usp43 G A 11: 67,891,458 P378L probably damaging Het
Vmn1r212 A G 13: 22,883,765 F133L probably benign Het
Vmn1r213 A G 13: 23,011,740 I164M possibly damaging Het
Vmn2r19 C T 6: 123,316,039 P347S probably damaging Het
Zfp106 A T 2: 120,524,519 V1280E possibly damaging Het
Zfp317 T C 9: 19,641,969 S13P probably benign Het
Zfp608 C A 18: 54,899,546 A441S probably benign Het
Zufsp T C 10: 33,940,252 D232G probably damaging Het
Other mutations in Olfr44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Olfr44 APN 9 39484648 missense probably benign 0.02
IGL02239:Olfr44 APN 9 39484561 missense probably damaging 1.00
IGL02305:Olfr44 APN 9 39485037 missense probably damaging 0.97
IGL02353:Olfr44 APN 9 39485148 missense probably benign
IGL02360:Olfr44 APN 9 39485148 missense probably benign
R0212:Olfr44 UTSW 9 39485088 missense probably damaging 1.00
R0600:Olfr44 UTSW 9 39484988 missense probably benign 0.34
R1329:Olfr44 UTSW 9 39484444 missense probably damaging 0.97
R1348:Olfr44 UTSW 9 39485236 missense probably benign
R1594:Olfr44 UTSW 9 39484746 missense probably benign 0.03
R5017:Olfr44 UTSW 9 39484755 missense possibly damaging 0.90
R5141:Olfr44 UTSW 9 39484531 missense probably damaging 1.00
R5244:Olfr44 UTSW 9 39484512 missense probably damaging 1.00
R5524:Olfr44 UTSW 9 39484987 missense probably damaging 0.97
R5630:Olfr44 UTSW 9 39484951 missense probably benign 0.00
R5860:Olfr44 UTSW 9 39484471 missense probably benign 0.07
R6444:Olfr44 UTSW 9 39484318 missense probably benign 0.04
R6649:Olfr44 UTSW 9 39484752 missense probably benign 0.02
R6653:Olfr44 UTSW 9 39484752 missense probably benign 0.02
R7115:Olfr44 UTSW 9 39484648 missense probably benign 0.02
R7595:Olfr44 UTSW 9 39484315 missense probably benign 0.05
R7791:Olfr44 UTSW 9 39484881 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTTAGACCTGCCTTCAGTG -3'
(R):5'- TCCTCATATTTGCAATTGCGGAG -3'

Sequencing Primer
(F):5'- CTGCCTTCAGTGGAGCGAATG -3'
(R):5'- CATATTTGCAATTGCGGAGTGTTAC -3'
Posted On2020-01-23