Incidental Mutation 'R8054:Jade2'
ID619277
Institutional Source Beutler Lab
Gene Symbol Jade2
Ensembl Gene ENSMUSG00000020387
Gene Namejade family PHD finger 2
SynonymsPhf15, 1200017K05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8054 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location51813455-51857653 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 51818614 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 523 (R523G)
Ref Sequence ENSEMBL: ENSMUSP00000020655 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020655] [ENSMUST00000109090] [ENSMUST00000109091]
Predicted Effect probably benign
Transcript: ENSMUST00000020655
AA Change: R523G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000020655
Gene: ENSMUSG00000020387
AA Change: R523G

DomainStartEndE-ValueType
Pfam:EPL1 39 177 3.4e-17 PFAM
PHD 201 247 1.35e-10 SMART
PHD 310 365 1.74e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109090
AA Change: R523G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104718
Gene: ENSMUSG00000020387
AA Change: R523G

DomainStartEndE-ValueType
Pfam:EPL1 39 177 2e-17 PFAM
PHD 201 247 1.35e-10 SMART
PHD 310 365 1.74e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109091
AA Change: R523G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000104719
Gene: ENSMUSG00000020387
AA Change: R523G

DomainStartEndE-ValueType
Pfam:EPL1 2 176 9.6e-9 PFAM
PHD 201 247 1.35e-10 SMART
PHD 310 365 1.74e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (75/75)
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b A G 5: 8,824,272 N399S probably benign Het
Akap9 T C 5: 4,038,707 probably null Het
Ankrd17 A G 5: 90,291,055 I483T probably benign Het
Arl13b T C 16: 62,806,597 D247G probably benign Het
Brca2 A G 5: 150,536,504 I415V probably benign Het
Brpf3 C A 17: 28,836,597 S1173R probably damaging Het
Ccar1 A G 10: 62,747,436 L966P unknown Het
Ccdc129 A T 6: 55,976,439 K913N probably damaging Het
Cfap61 A G 2: 145,973,518 N249S probably damaging Het
Clip4 T A 17: 71,834,273 Y541N possibly damaging Het
Csn2 C T 5: 87,698,027 probably null Het
Cyp2c23 T G 19: 44,007,116 E404A probably damaging Het
Cyp2e1 A G 7: 140,770,958 E281G possibly damaging Het
Cyp2r1 T A 7: 114,552,084 probably null Het
D430041D05Rik T A 2: 104,155,045 I1226F possibly damaging Het
Dbx1 A T 7: 49,632,750 W236R probably damaging Het
Dcp2 T G 18: 44,405,707 N251K probably benign Het
Disp1 A T 1: 183,088,248 Y869* probably null Het
Dnajc8 T A 4: 132,544,757 probably benign Het
Ehhadh A G 16: 21,773,493 probably null Het
Eml3 A T 19: 8,939,050 T670S possibly damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fbn1 A T 2: 125,346,018 D1530E possibly damaging Het
Gm11639 A G 11: 104,730,400 N822D probably benign Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Hsd3b3 A T 3: 98,742,015 Y331N probably damaging Het
Ino80d T C 1: 63,058,678 R791G possibly damaging Het
Kmt2d A T 15: 98,843,925 D4451E unknown Het
Lax1 T C 1: 133,683,607 T76A probably benign Het
Map4k1 A G 7: 28,989,756 probably benign Het
Mcu G A 10: 59,454,995 T121M probably damaging Het
Mepce T A 5: 137,784,742 K441* probably null Het
Mettl21e C A 1: 44,206,655 V144F probably damaging Het
Muc6 T A 7: 141,645,481 S1049C probably damaging Het
Myh14 C T 7: 44,625,127 V1246M probably damaging Het
Myo3a A T 2: 22,574,317 Q1128L probably benign Het
Nat8f2 T C 6: 85,867,772 S203G probably benign Het
Npas2 A G 1: 39,287,571 T46A possibly damaging Het
Nup133 T C 8: 123,949,217 probably benign Het
Olfr11 A T 13: 21,638,949 D191E probably benign Het
Olfr1375 T A 11: 51,048,263 I52N probably benign Het
Olfr213 A G 6: 116,540,999 H182R probably damaging Het
Olfr44 C A 9: 39,484,737 C172F probably damaging Het
Olfr998 A T 2: 85,590,840 Q100L probably damaging Het
Oplah C T 15: 76,306,257 R102H probably benign Het
Osgep C T 14: 50,924,671 probably benign Het
Pam A T 1: 97,840,389 D705E probably damaging Het
Papd5 T A 8: 88,247,558 I294N probably damaging Het
Pkd1l3 C G 8: 109,646,376 N1284K probably damaging Het
Plekhg2 A G 7: 28,365,316 F407S probably damaging Het
Pygl A G 12: 70,227,339 probably null Het
Rcc2 G A 4: 140,702,275 C40Y probably benign Het
Rhobtb1 A G 10: 69,248,890 N37S probably damaging Het
Sema6a T A 18: 47,291,905 D213V probably damaging Het
Skint11 A T 4: 114,244,609 Q273L possibly damaging Het
Skint7 A T 4: 111,982,229 H240L probably benign Het
Slc12a2 C T 18: 57,921,872 Q862* probably null Het
Smox A G 2: 131,522,180 S468G probably benign Het
Spc25 A G 2: 69,204,913 S50P probably damaging Het
Spert A G 14: 75,583,899 Y129H probably benign Het
Srrm1 A T 4: 135,325,015 S683T unknown Het
Syne1 T C 10: 5,270,970 E3103G probably benign Het
Tenm4 C A 7: 96,729,346 probably benign Het
Tmem123 T C 9: 7,791,063 S122P possibly damaging Het
Trav18 A T 14: 53,831,115 K4I probably benign Het
Triml1 T C 8: 43,130,383 S394G probably damaging Het
Ubr4 A T 4: 139,468,102 S1212C unknown Het
Usp34 G A 11: 23,361,295 R442Q Het
Usp43 G A 11: 67,891,458 P378L probably damaging Het
Vmn1r212 A G 13: 22,883,765 F133L probably benign Het
Vmn1r213 A G 13: 23,011,740 I164M possibly damaging Het
Vmn2r19 C T 6: 123,316,039 P347S probably damaging Het
Zfp106 A T 2: 120,524,519 V1280E possibly damaging Het
Zfp317 T C 9: 19,641,969 S13P probably benign Het
Zfp608 C A 18: 54,899,546 A441S probably benign Het
Zufsp T C 10: 33,940,252 D232G probably damaging Het
Other mutations in Jade2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01323:Jade2 APN 11 51825338 missense possibly damaging 0.95
IGL01935:Jade2 APN 11 51828384 missense possibly damaging 0.95
IGL02885:Jade2 APN 11 51831296 missense probably damaging 1.00
IGL02987:Jade2 APN 11 51830481 missense probably damaging 1.00
IGL02990:Jade2 APN 11 51831247 splice site probably benign
IGL03172:Jade2 APN 11 51825371 missense probably damaging 1.00
R0116:Jade2 UTSW 11 51831309 missense probably damaging 1.00
R1917:Jade2 UTSW 11 51818538 missense possibly damaging 0.95
R3410:Jade2 UTSW 11 51817223 missense probably benign
R3886:Jade2 UTSW 11 51830499 missense possibly damaging 0.79
R4846:Jade2 UTSW 11 51821148 missense probably benign
R4916:Jade2 UTSW 11 51817082 missense probably benign 0.01
R5420:Jade2 UTSW 11 51818607 missense probably benign 0.21
R5446:Jade2 UTSW 11 51816959 missense probably benign
R5657:Jade2 UTSW 11 51816987 missense probably damaging 1.00
R6031:Jade2 UTSW 11 51826586 nonsense probably null
R6031:Jade2 UTSW 11 51826586 nonsense probably null
R6116:Jade2 UTSW 11 51835633 missense probably damaging 0.99
R7039:Jade2 UTSW 11 51828359 missense probably damaging 0.97
R7270:Jade2 UTSW 11 51817184 missense possibly damaging 0.89
R7702:Jade2 UTSW 11 51816917 missense probably damaging 1.00
R7797:Jade2 UTSW 11 51817299 missense probably benign 0.00
R8243:Jade2 UTSW 11 51817218 missense probably benign
R8371:Jade2 UTSW 11 51825132 missense probably benign 0.04
Z1177:Jade2 UTSW 11 51816990 missense probably damaging 0.96
Z1177:Jade2 UTSW 11 51848994 missense probably null 0.20
Predicted Primers PCR Primer
(F):5'- GATCTCTTGTGCGTGAGACG -3'
(R):5'- CCACAAGGACTTATTATGCCTTCC -3'

Sequencing Primer
(F):5'- CACTGTGAGCCCTGGAAGAG -3'
(R):5'- AAGGACTTATTATGCCTTCCTCTATC -3'
Posted On2020-01-23