Incidental Mutation 'R8054:Kmt2d'
ID619287
Institutional Source Beutler Lab
Gene Symbol Kmt2d
Ensembl Gene ENSMUSG00000048154
Gene Namelysine (K)-specific methyltransferase 2D
SynonymsMll2, C430014K11Rik, Mll4
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8054 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location98831669-98871204 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 98843925 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 4451 (D4451E)
Ref Sequence ENSEMBL: ENSMUSP00000023741 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023741] [ENSMUST00000178486]
Predicted Effect unknown
Transcript: ENSMUST00000023741
AA Change: D4451E
SMART Domains Protein: ENSMUSP00000023741
Gene: ENSMUSG00000048154
AA Change: D4451E

DomainStartEndE-ValueType
low complexity region 135 145 N/A INTRINSIC
PHD 171 218 1.65e-5 SMART
RING 172 217 2.01e0 SMART
PHD 228 274 2.13e-8 SMART
RING 229 273 2.11e-3 SMART
PHD 275 321 1.57e-11 SMART
RING 276 320 2.36e0 SMART
low complexity region 430 489 N/A INTRINSIC
low complexity region 500 562 N/A INTRINSIC
low complexity region 564 613 N/A INTRINSIC
low complexity region 619 717 N/A INTRINSIC
internal_repeat_3 719 768 2.82e-8 PROSPERO
internal_repeat_3 773 822 2.82e-8 PROSPERO
low complexity region 826 842 N/A INTRINSIC
low complexity region 844 919 N/A INTRINSIC
low complexity region 958 981 N/A INTRINSIC
low complexity region 985 1023 N/A INTRINSIC
low complexity region 1069 1076 N/A INTRINSIC
low complexity region 1139 1153 N/A INTRINSIC
low complexity region 1259 1285 N/A INTRINSIC
low complexity region 1307 1314 N/A INTRINSIC
PHD 1335 1384 7.01e-9 SMART
RING 1336 1383 1.46e1 SMART
PHD 1385 1431 8.56e-13 SMART
PHD 1462 1513 1.11e-6 SMART
RING 1463 1512 1.46e1 SMART
low complexity region 1514 1538 N/A INTRINSIC
low complexity region 1567 1576 N/A INTRINSIC
low complexity region 1589 1612 N/A INTRINSIC
low complexity region 1634 1646 N/A INTRINSIC
low complexity region 1707 1719 N/A INTRINSIC
low complexity region 1883 1896 N/A INTRINSIC
low complexity region 1931 1950 N/A INTRINSIC
HMG 1969 2037 6.35e-6 SMART
low complexity region 2064 2079 N/A INTRINSIC
low complexity region 2147 2167 N/A INTRINSIC
low complexity region 2170 2181 N/A INTRINSIC
low complexity region 2306 2323 N/A INTRINSIC
low complexity region 2334 2359 N/A INTRINSIC
low complexity region 2366 2388 N/A INTRINSIC
low complexity region 2402 2419 N/A INTRINSIC
low complexity region 2546 2559 N/A INTRINSIC
low complexity region 2610 2622 N/A INTRINSIC
coiled coil region 2632 2665 N/A INTRINSIC
coiled coil region 2768 2813 N/A INTRINSIC
low complexity region 2855 2868 N/A INTRINSIC
low complexity region 2887 2899 N/A INTRINSIC
low complexity region 3151 3165 N/A INTRINSIC
low complexity region 3189 3204 N/A INTRINSIC
low complexity region 3241 3263 N/A INTRINSIC
low complexity region 3390 3400 N/A INTRINSIC
low complexity region 3629 3659 N/A INTRINSIC
coiled coil region 3712 3749 N/A INTRINSIC
low complexity region 3781 3801 N/A INTRINSIC
coiled coil region 3910 4003 N/A INTRINSIC
low complexity region 4128 4159 N/A INTRINSIC
low complexity region 4167 4183 N/A INTRINSIC
low complexity region 4226 4246 N/A INTRINSIC
low complexity region 4266 4293 N/A INTRINSIC
low complexity region 4306 4322 N/A INTRINSIC
low complexity region 4361 4378 N/A INTRINSIC
coiled coil region 4591 4613 N/A INTRINSIC
low complexity region 4661 4684 N/A INTRINSIC
low complexity region 4745 4755 N/A INTRINSIC
low complexity region 4877 4896 N/A INTRINSIC
low complexity region 4957 4983 N/A INTRINSIC
low complexity region 4989 5029 N/A INTRINSIC
low complexity region 5100 5107 N/A INTRINSIC
PHD 5142 5188 4.67e-5 SMART
RING 5143 5187 4.87e0 SMART
FYRN 5242 5285 5.07e-21 SMART
FYRC 5291 5378 2.51e-43 SMART
SET 5448 5570 5.69e-36 SMART
PostSET 5572 5588 3.58e-5 SMART
Predicted Effect unknown
Transcript: ENSMUST00000178486
AA Change: D4451E
SMART Domains Protein: ENSMUSP00000135941
Gene: ENSMUSG00000048154
AA Change: D4451E

DomainStartEndE-ValueType
low complexity region 135 145 N/A INTRINSIC
PHD 171 218 1.65e-5 SMART
RING 172 217 2.01e0 SMART
PHD 228 274 2.13e-8 SMART
RING 229 273 2.11e-3 SMART
PHD 275 321 1.57e-11 SMART
RING 276 320 2.36e0 SMART
low complexity region 430 489 N/A INTRINSIC
low complexity region 500 562 N/A INTRINSIC
low complexity region 564 613 N/A INTRINSIC
low complexity region 619 717 N/A INTRINSIC
internal_repeat_3 719 768 2.82e-8 PROSPERO
internal_repeat_3 773 822 2.82e-8 PROSPERO
low complexity region 826 842 N/A INTRINSIC
low complexity region 844 919 N/A INTRINSIC
low complexity region 958 981 N/A INTRINSIC
low complexity region 985 1023 N/A INTRINSIC
low complexity region 1069 1076 N/A INTRINSIC
low complexity region 1139 1153 N/A INTRINSIC
low complexity region 1259 1285 N/A INTRINSIC
low complexity region 1307 1314 N/A INTRINSIC
PHD 1335 1384 7.01e-9 SMART
RING 1336 1383 1.46e1 SMART
PHD 1385 1431 8.56e-13 SMART
PHD 1462 1513 1.11e-6 SMART
RING 1463 1512 1.46e1 SMART
low complexity region 1514 1538 N/A INTRINSIC
low complexity region 1567 1576 N/A INTRINSIC
low complexity region 1589 1612 N/A INTRINSIC
low complexity region 1634 1646 N/A INTRINSIC
low complexity region 1707 1719 N/A INTRINSIC
low complexity region 1883 1896 N/A INTRINSIC
low complexity region 1931 1950 N/A INTRINSIC
HMG 1969 2037 6.35e-6 SMART
low complexity region 2064 2079 N/A INTRINSIC
low complexity region 2147 2167 N/A INTRINSIC
low complexity region 2170 2181 N/A INTRINSIC
low complexity region 2306 2323 N/A INTRINSIC
low complexity region 2334 2359 N/A INTRINSIC
low complexity region 2366 2388 N/A INTRINSIC
low complexity region 2402 2419 N/A INTRINSIC
low complexity region 2546 2559 N/A INTRINSIC
low complexity region 2610 2622 N/A INTRINSIC
coiled coil region 2632 2665 N/A INTRINSIC
coiled coil region 2768 2813 N/A INTRINSIC
low complexity region 2855 2868 N/A INTRINSIC
low complexity region 2887 2899 N/A INTRINSIC
low complexity region 3151 3165 N/A INTRINSIC
low complexity region 3189 3204 N/A INTRINSIC
low complexity region 3241 3263 N/A INTRINSIC
low complexity region 3390 3400 N/A INTRINSIC
low complexity region 3629 3659 N/A INTRINSIC
coiled coil region 3712 3749 N/A INTRINSIC
low complexity region 3781 3801 N/A INTRINSIC
coiled coil region 3910 4003 N/A INTRINSIC
low complexity region 4128 4159 N/A INTRINSIC
low complexity region 4167 4183 N/A INTRINSIC
low complexity region 4226 4246 N/A INTRINSIC
low complexity region 4266 4293 N/A INTRINSIC
low complexity region 4306 4322 N/A INTRINSIC
low complexity region 4361 4378 N/A INTRINSIC
coiled coil region 4591 4613 N/A INTRINSIC
low complexity region 4661 4684 N/A INTRINSIC
low complexity region 4745 4755 N/A INTRINSIC
low complexity region 4877 4896 N/A INTRINSIC
low complexity region 4957 4983 N/A INTRINSIC
low complexity region 4989 5029 N/A INTRINSIC
low complexity region 5100 5107 N/A INTRINSIC
PHD 5142 5188 4.67e-5 SMART
RING 5143 5187 4.87e0 SMART
FYRN 5242 5285 5.07e-21 SMART
FYRC 5291 5378 2.51e-43 SMART
SET 5448 5570 5.69e-36 SMART
PostSET 5572 5588 3.58e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000229651
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a histone methyltransferase that methylates the Lys-4 position of histone H3. The encoded protein is part of a large protein complex called ASCOM, which has been shown to be a transcriptional regulator of the beta-globin and estrogen receptor genes. Mutations in this gene have been shown to be a cause of Kabuki syndrome. [provided by RefSeq, Oct 2010]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit embryonic lethality around E9.5. Mice homozygous for a conditional allele activated in different cell-types exhibit impaired adipogenesis, impaired myogenesis, perturbed germinal B cell development and promoteion of lymphomagenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b A G 5: 8,824,272 N399S probably benign Het
Akap9 T C 5: 4,038,707 probably null Het
Ankrd17 A G 5: 90,291,055 I483T probably benign Het
Arl13b T C 16: 62,806,597 D247G probably benign Het
Brca2 A G 5: 150,536,504 I415V probably benign Het
Brpf3 C A 17: 28,836,597 S1173R probably damaging Het
Ccar1 A G 10: 62,747,436 L966P unknown Het
Ccdc129 A T 6: 55,976,439 K913N probably damaging Het
Cfap61 A G 2: 145,973,518 N249S probably damaging Het
Clip4 T A 17: 71,834,273 Y541N possibly damaging Het
Csn2 C T 5: 87,698,027 probably null Het
Cyp2c23 T G 19: 44,007,116 E404A probably damaging Het
Cyp2e1 A G 7: 140,770,958 E281G possibly damaging Het
Cyp2r1 T A 7: 114,552,084 probably null Het
D430041D05Rik T A 2: 104,155,045 I1226F possibly damaging Het
Dbx1 A T 7: 49,632,750 W236R probably damaging Het
Dcp2 T G 18: 44,405,707 N251K probably benign Het
Disp1 A T 1: 183,088,248 Y869* probably null Het
Dnajc8 T A 4: 132,544,757 probably benign Het
Ehhadh A G 16: 21,773,493 probably null Het
Eml3 A T 19: 8,939,050 T670S possibly damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fbn1 A T 2: 125,346,018 D1530E possibly damaging Het
Gm11639 A G 11: 104,730,400 N822D probably benign Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Hsd3b3 A T 3: 98,742,015 Y331N probably damaging Het
Ino80d T C 1: 63,058,678 R791G possibly damaging Het
Jade2 T C 11: 51,818,614 R523G probably benign Het
Lax1 T C 1: 133,683,607 T76A probably benign Het
Map4k1 A G 7: 28,989,756 probably benign Het
Mcu G A 10: 59,454,995 T121M probably damaging Het
Mepce T A 5: 137,784,742 K441* probably null Het
Mettl21e C A 1: 44,206,655 V144F probably damaging Het
Muc6 T A 7: 141,645,481 S1049C probably damaging Het
Myh14 C T 7: 44,625,127 V1246M probably damaging Het
Myo3a A T 2: 22,574,317 Q1128L probably benign Het
Nat8f2 T C 6: 85,867,772 S203G probably benign Het
Npas2 A G 1: 39,287,571 T46A possibly damaging Het
Nup133 T C 8: 123,949,217 probably benign Het
Olfr11 A T 13: 21,638,949 D191E probably benign Het
Olfr1375 T A 11: 51,048,263 I52N probably benign Het
Olfr213 A G 6: 116,540,999 H182R probably damaging Het
Olfr44 C A 9: 39,484,737 C172F probably damaging Het
Olfr998 A T 2: 85,590,840 Q100L probably damaging Het
Oplah C T 15: 76,306,257 R102H probably benign Het
Osgep C T 14: 50,924,671 probably benign Het
Pam A T 1: 97,840,389 D705E probably damaging Het
Papd5 T A 8: 88,247,558 I294N probably damaging Het
Pkd1l3 C G 8: 109,646,376 N1284K probably damaging Het
Plekhg2 A G 7: 28,365,316 F407S probably damaging Het
Pygl A G 12: 70,227,339 probably null Het
Rcc2 G A 4: 140,702,275 C40Y probably benign Het
Rhobtb1 A G 10: 69,248,890 N37S probably damaging Het
Sema6a T A 18: 47,291,905 D213V probably damaging Het
Skint11 A T 4: 114,244,609 Q273L possibly damaging Het
Skint7 A T 4: 111,982,229 H240L probably benign Het
Slc12a2 C T 18: 57,921,872 Q862* probably null Het
Smox A G 2: 131,522,180 S468G probably benign Het
Spc25 A G 2: 69,204,913 S50P probably damaging Het
Spert A G 14: 75,583,899 Y129H probably benign Het
Srrm1 A T 4: 135,325,015 S683T unknown Het
Syne1 T C 10: 5,270,970 E3103G probably benign Het
Tenm4 C A 7: 96,729,346 probably benign Het
Tmem123 T C 9: 7,791,063 S122P possibly damaging Het
Trav18 A T 14: 53,831,115 K4I probably benign Het
Triml1 T C 8: 43,130,383 S394G probably damaging Het
Ubr4 A T 4: 139,468,102 S1212C unknown Het
Usp34 G A 11: 23,361,295 R442Q Het
Usp43 G A 11: 67,891,458 P378L probably damaging Het
Vmn1r212 A G 13: 22,883,765 F133L probably benign Het
Vmn1r213 A G 13: 23,011,740 I164M possibly damaging Het
Vmn2r19 C T 6: 123,316,039 P347S probably damaging Het
Zfp106 A T 2: 120,524,519 V1280E possibly damaging Het
Zfp317 T C 9: 19,641,969 S13P probably benign Het
Zfp608 C A 18: 54,899,546 A441S probably benign Het
Zufsp T C 10: 33,940,252 D232G probably damaging Het
Other mutations in Kmt2d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Kmt2d APN 15 98862333 missense unknown
IGL00927:Kmt2d APN 15 98845009 unclassified probably benign
IGL01123:Kmt2d APN 15 98837148 missense unknown
IGL01288:Kmt2d APN 15 98865044 missense probably damaging 1.00
IGL01538:Kmt2d APN 15 98860657 unclassified probably benign
IGL01575:Kmt2d APN 15 98846855 utr 3 prime probably benign
IGL01584:Kmt2d APN 15 98856369 unclassified probably benign
IGL01750:Kmt2d APN 15 98853168 unclassified probably benign
IGL02163:Kmt2d APN 15 98835228 unclassified probably benign
IGL02209:Kmt2d APN 15 98854567 unclassified probably benign
IGL02253:Kmt2d APN 15 98858175 unclassified probably benign
IGL02271:Kmt2d APN 15 98866428 missense possibly damaging 0.89
IGL02291:Kmt2d APN 15 98865492 splice site probably benign
IGL02448:Kmt2d APN 15 98844110 unclassified probably benign
IGL02472:Kmt2d APN 15 98850077 missense probably benign 0.23
IGL02496:Kmt2d APN 15 98857558 unclassified probably benign
IGL02527:Kmt2d APN 15 98841747 unclassified probably benign
IGL02576:Kmt2d APN 15 98864120 missense unknown
IGL02597:Kmt2d APN 15 98863831 missense unknown
IGL02609:Kmt2d APN 15 98851793 unclassified probably benign
IGL03085:Kmt2d APN 15 98839940 unclassified probably benign
IGL03102:Kmt2d APN 15 98855543 missense probably benign
IGL03123:Kmt2d APN 15 98861771 missense unknown
R0091:Kmt2d UTSW 15 98844479 unclassified probably benign
R0136:Kmt2d UTSW 15 98854278 unclassified probably benign
R0243:Kmt2d UTSW 15 98850137 unclassified probably benign
R0276:Kmt2d UTSW 15 98850311 unclassified probably benign
R0477:Kmt2d UTSW 15 98853581 unclassified probably benign
R0478:Kmt2d UTSW 15 98853581 unclassified probably benign
R0586:Kmt2d UTSW 15 98835207 unclassified probably benign
R0632:Kmt2d UTSW 15 98853581 unclassified probably benign
R0678:Kmt2d UTSW 15 98850413 unclassified probably benign
R0780:Kmt2d UTSW 15 98862857 missense unknown
R0891:Kmt2d UTSW 15 98852691 unclassified probably benign
R1136:Kmt2d UTSW 15 98857765 unclassified probably benign
R1417:Kmt2d UTSW 15 98866430 missense probably damaging 0.99
R1499:Kmt2d UTSW 15 98844938 unclassified probably benign
R1510:Kmt2d UTSW 15 98856377 unclassified probably benign
R1586:Kmt2d UTSW 15 98865053 splice site probably benign
R1640:Kmt2d UTSW 15 98845057 unclassified probably benign
R1714:Kmt2d UTSW 15 98862950 missense unknown
R1725:Kmt2d UTSW 15 98845234 unclassified probably benign
R1728:Kmt2d UTSW 15 98865132 missense probably damaging 1.00
R1729:Kmt2d UTSW 15 98865132 missense probably damaging 1.00
R1741:Kmt2d UTSW 15 98845234 unclassified probably benign
R1744:Kmt2d UTSW 15 98865047 missense probably damaging 0.99
R1746:Kmt2d UTSW 15 98864378 missense probably damaging 0.97
R1753:Kmt2d UTSW 15 98843482 unclassified probably benign
R1782:Kmt2d UTSW 15 98857548 unclassified probably benign
R1789:Kmt2d UTSW 15 98852074 unclassified probably benign
R1802:Kmt2d UTSW 15 98862985 missense unknown
R1808:Kmt2d UTSW 15 98866686 missense probably damaging 1.00
R1822:Kmt2d UTSW 15 98861780 missense unknown
R1831:Kmt2d UTSW 15 98855343 missense probably damaging 0.97
R1920:Kmt2d UTSW 15 98855590 missense probably damaging 0.96
R1920:Kmt2d UTSW 15 98855591 missense probably damaging 1.00
R1956:Kmt2d UTSW 15 98859590 unclassified probably benign
R2100:Kmt2d UTSW 15 98846480 unclassified probably benign
R2120:Kmt2d UTSW 15 98839529 unclassified probably benign
R2188:Kmt2d UTSW 15 98839300 unclassified probably benign
R2191:Kmt2d UTSW 15 98861049 critical splice donor site probably null
R2234:Kmt2d UTSW 15 98865248 missense probably damaging 0.98
R2422:Kmt2d UTSW 15 98862266 missense unknown
R2762:Kmt2d UTSW 15 98852055 unclassified probably benign
R2895:Kmt2d UTSW 15 98843939 unclassified probably benign
R3624:Kmt2d UTSW 15 98842902 unclassified probably benign
R3791:Kmt2d UTSW 15 98844149 unclassified probably benign
R3794:Kmt2d UTSW 15 98837359 unclassified probably benign
R3871:Kmt2d UTSW 15 98851021 unclassified probably benign
R3958:Kmt2d UTSW 15 98855549 missense possibly damaging 0.69
R3983:Kmt2d UTSW 15 98846046 unclassified probably benign
R4211:Kmt2d UTSW 15 98840189 unclassified probably benign
R4212:Kmt2d UTSW 15 98845003 unclassified probably benign
R4240:Kmt2d UTSW 15 98844571 unclassified probably benign
R4246:Kmt2d UTSW 15 98840089 unclassified probably benign
R4361:Kmt2d UTSW 15 98863670 missense unknown
R4388:Kmt2d UTSW 15 98853626 unclassified probably benign
R4602:Kmt2d UTSW 15 98850259 unclassified probably benign
R4606:Kmt2d UTSW 15 98839716 unclassified probably benign
R4658:Kmt2d UTSW 15 98852529 unclassified probably benign
R4840:Kmt2d UTSW 15 98861894 missense unknown
R4895:Kmt2d UTSW 15 98844487 unclassified probably benign
R4906:Kmt2d UTSW 15 98849539 unclassified probably benign
R4976:Kmt2d UTSW 15 98847194 utr 3 prime probably benign
R5093:Kmt2d UTSW 15 98856162 missense probably damaging 1.00
R5119:Kmt2d UTSW 15 98847194 utr 3 prime probably benign
R5160:Kmt2d UTSW 15 98840224 unclassified probably benign
R5260:Kmt2d UTSW 15 98842860 unclassified probably benign
R5274:Kmt2d UTSW 15 98854230 unclassified probably benign
R5450:Kmt2d UTSW 15 98855086 missense probably damaging 1.00
R5461:Kmt2d UTSW 15 98852109 unclassified probably benign
R5462:Kmt2d UTSW 15 98852109 unclassified probably benign
R5463:Kmt2d UTSW 15 98852109 unclassified probably benign
R5465:Kmt2d UTSW 15 98852109 unclassified probably benign
R5467:Kmt2d UTSW 15 98852109 unclassified probably benign
R5481:Kmt2d UTSW 15 98862005 missense unknown
R5509:Kmt2d UTSW 15 98839676 unclassified probably benign
R5534:Kmt2d UTSW 15 98837357 unclassified probably benign
R5536:Kmt2d UTSW 15 98852109 unclassified probably benign
R5537:Kmt2d UTSW 15 98852109 unclassified probably benign
R5538:Kmt2d UTSW 15 98852109 unclassified probably benign
R5546:Kmt2d UTSW 15 98853068 unclassified probably benign
R5595:Kmt2d UTSW 15 98850024 unclassified probably benign
R5645:Kmt2d UTSW 15 98844397 unclassified probably benign
R5679:Kmt2d UTSW 15 98854272 unclassified probably benign
R5710:Kmt2d UTSW 15 98854106 unclassified probably benign
R5755:Kmt2d UTSW 15 98863646 missense unknown
R5817:Kmt2d UTSW 15 98862363 missense unknown
R5841:Kmt2d UTSW 15 98852109 unclassified probably benign
R5842:Kmt2d UTSW 15 98852109 unclassified probably benign
R5843:Kmt2d UTSW 15 98852109 unclassified probably benign
R5844:Kmt2d UTSW 15 98852109 unclassified probably benign
R5845:Kmt2d UTSW 15 98852109 unclassified probably benign
R6122:Kmt2d UTSW 15 98860692 unclassified probably benign
R6612:Kmt2d UTSW 15 98845858 unclassified probably benign
R6718:Kmt2d UTSW 15 98849586 unclassified probably benign
R6718:Kmt2d UTSW 15 98850539 unclassified probably benign
R6822:Kmt2d UTSW 15 98849459 unclassified probably benign
R6866:Kmt2d UTSW 15 98857393 unclassified probably benign
R6950:Kmt2d UTSW 15 98840020 unclassified probably benign
R7089:Kmt2d UTSW 15 98850272 missense unknown
R7120:Kmt2d UTSW 15 98861065 missense unknown
R7131:Kmt2d UTSW 15 98849616 unclassified probably benign
R7177:Kmt2d UTSW 15 98850386 missense unknown
R7194:Kmt2d UTSW 15 98843833 missense unknown
R7252:Kmt2d UTSW 15 98844266 missense unknown
R7282:Kmt2d UTSW 15 98854104 missense unknown
R7307:Kmt2d UTSW 15 98849418 missense unknown
R7313:Kmt2d UTSW 15 98856623 missense unknown
R7394:Kmt2d UTSW 15 98856384 missense unknown
R7404:Kmt2d UTSW 15 98845495 missense unknown
R7409:Kmt2d UTSW 15 98855354 missense probably damaging 1.00
R7414:Kmt2d UTSW 15 98839856 missense unknown
R7534:Kmt2d UTSW 15 98852018 missense unknown
R7575:Kmt2d UTSW 15 98849611 unclassified probably benign
R7650:Kmt2d UTSW 15 98850870 missense unknown
R7687:Kmt2d UTSW 15 98862120 missense unknown
R7699:Kmt2d UTSW 15 98843719 missense unknown
R7700:Kmt2d UTSW 15 98843719 missense unknown
R7765:Kmt2d UTSW 15 98852334 missense unknown
R7797:Kmt2d UTSW 15 98864406 missense probably benign 0.24
R7803:Kmt2d UTSW 15 98862923 missense unknown
R7952:Kmt2d UTSW 15 98850768 missense unknown
R8084:Kmt2d UTSW 15 98842064 missense unknown
R8089:Kmt2d UTSW 15 98842869 missense unknown
R8133:Kmt2d UTSW 15 98864942 missense probably damaging 1.00
R8138:Kmt2d UTSW 15 98843653 missense unknown
R8343:Kmt2d UTSW 15 98852597 missense unknown
X0018:Kmt2d UTSW 15 98852922 unclassified probably benign
X0024:Kmt2d UTSW 15 98853053 unclassified probably benign
X0062:Kmt2d UTSW 15 98849819 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TTGCCCGTAGAAGCTTCTGC -3'
(R):5'- GCCTTATCTACAGGACCAGTGC -3'

Sequencing Primer
(F):5'- CCCGTAGAAGCTTCTGCAAGAG -3'
(R):5'- ACAATTACCTTCCCCCAGTG -3'
Posted On2020-01-23