Incidental Mutation 'R8054:Cyp2c23'
ID619297
Institutional Source Beutler Lab
Gene Symbol Cyp2c23
Ensembl Gene ENSMUSG00000025197
Gene Namecytochrome P450, family 2, subfamily c, polypeptide 23
SynonymsCyp2c44
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8054 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location44005022-44029208 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 44007116 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Alanine at position 404 (E404A)
Ref Sequence ENSEMBL: ENSMUSP00000026211 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026211] [ENSMUST00000211830]
Predicted Effect probably damaging
Transcript: ENSMUST00000026211
AA Change: E404A

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000026211
Gene: ENSMUSG00000025197
AA Change: E404A

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:p450 34 491 2.1e-152 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000211830
AA Change: E404A

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (75/75)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele show reduced proliferative and tubulogenic responses in lung endothelial cells, decreased tumor angiogenesis and growth of induced tumors, and high potassium-induced hypertension with decreased urinary sodium excretion and increased plasma sodium levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b A G 5: 8,824,272 N399S probably benign Het
Akap9 T C 5: 4,038,707 probably null Het
Ankrd17 A G 5: 90,291,055 I483T probably benign Het
Arl13b T C 16: 62,806,597 D247G probably benign Het
Brca2 A G 5: 150,536,504 I415V probably benign Het
Brpf3 C A 17: 28,836,597 S1173R probably damaging Het
Ccar1 A G 10: 62,747,436 L966P unknown Het
Ccdc129 A T 6: 55,976,439 K913N probably damaging Het
Cfap61 A G 2: 145,973,518 N249S probably damaging Het
Clip4 T A 17: 71,834,273 Y541N possibly damaging Het
Csn2 C T 5: 87,698,027 probably null Het
Cyp2e1 A G 7: 140,770,958 E281G possibly damaging Het
Cyp2r1 T A 7: 114,552,084 probably null Het
D430041D05Rik T A 2: 104,155,045 I1226F possibly damaging Het
Dbx1 A T 7: 49,632,750 W236R probably damaging Het
Dcp2 T G 18: 44,405,707 N251K probably benign Het
Disp1 A T 1: 183,088,248 Y869* probably null Het
Dnajc8 T A 4: 132,544,757 probably benign Het
Ehhadh A G 16: 21,773,493 probably null Het
Eml3 A T 19: 8,939,050 T670S possibly damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fbn1 A T 2: 125,346,018 D1530E possibly damaging Het
Gm11639 A G 11: 104,730,400 N822D probably benign Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Hsd3b3 A T 3: 98,742,015 Y331N probably damaging Het
Ino80d T C 1: 63,058,678 R791G possibly damaging Het
Jade2 T C 11: 51,818,614 R523G probably benign Het
Kmt2d A T 15: 98,843,925 D4451E unknown Het
Lax1 T C 1: 133,683,607 T76A probably benign Het
Map4k1 A G 7: 28,989,756 probably benign Het
Mcu G A 10: 59,454,995 T121M probably damaging Het
Mepce T A 5: 137,784,742 K441* probably null Het
Mettl21e C A 1: 44,206,655 V144F probably damaging Het
Muc6 T A 7: 141,645,481 S1049C probably damaging Het
Myh14 C T 7: 44,625,127 V1246M probably damaging Het
Myo3a A T 2: 22,574,317 Q1128L probably benign Het
Nat8f2 T C 6: 85,867,772 S203G probably benign Het
Npas2 A G 1: 39,287,571 T46A possibly damaging Het
Nup133 T C 8: 123,949,217 probably benign Het
Olfr11 A T 13: 21,638,949 D191E probably benign Het
Olfr1375 T A 11: 51,048,263 I52N probably benign Het
Olfr213 A G 6: 116,540,999 H182R probably damaging Het
Olfr44 C A 9: 39,484,737 C172F probably damaging Het
Olfr998 A T 2: 85,590,840 Q100L probably damaging Het
Oplah C T 15: 76,306,257 R102H probably benign Het
Osgep C T 14: 50,924,671 probably benign Het
Pam A T 1: 97,840,389 D705E probably damaging Het
Papd5 T A 8: 88,247,558 I294N probably damaging Het
Pkd1l3 C G 8: 109,646,376 N1284K probably damaging Het
Plekhg2 A G 7: 28,365,316 F407S probably damaging Het
Pygl A G 12: 70,227,339 probably null Het
Rcc2 G A 4: 140,702,275 C40Y probably benign Het
Rhobtb1 A G 10: 69,248,890 N37S probably damaging Het
Sema6a T A 18: 47,291,905 D213V probably damaging Het
Skint11 A T 4: 114,244,609 Q273L possibly damaging Het
Skint7 A T 4: 111,982,229 H240L probably benign Het
Slc12a2 C T 18: 57,921,872 Q862* probably null Het
Smox A G 2: 131,522,180 S468G probably benign Het
Spc25 A G 2: 69,204,913 S50P probably damaging Het
Spert A G 14: 75,583,899 Y129H probably benign Het
Srrm1 A T 4: 135,325,015 S683T unknown Het
Syne1 T C 10: 5,270,970 E3103G probably benign Het
Tenm4 C A 7: 96,729,346 probably benign Het
Tmem123 T C 9: 7,791,063 S122P possibly damaging Het
Trav18 A T 14: 53,831,115 K4I probably benign Het
Triml1 T C 8: 43,130,383 S394G probably damaging Het
Ubr4 A T 4: 139,468,102 S1212C unknown Het
Usp34 G A 11: 23,361,295 R442Q Het
Usp43 G A 11: 67,891,458 P378L probably damaging Het
Vmn1r212 A G 13: 22,883,765 F133L probably benign Het
Vmn1r213 A G 13: 23,011,740 I164M possibly damaging Het
Vmn2r19 C T 6: 123,316,039 P347S probably damaging Het
Zfp106 A T 2: 120,524,519 V1280E possibly damaging Het
Zfp317 T C 9: 19,641,969 S13P probably benign Het
Zfp608 C A 18: 54,899,546 A441S probably benign Het
Zufsp T C 10: 33,940,252 D232G probably damaging Het
Other mutations in Cyp2c23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01467:Cyp2c23 APN 19 44015073 missense possibly damaging 0.94
IGL01642:Cyp2c23 APN 19 44005556 missense probably damaging 1.00
IGL01782:Cyp2c23 APN 19 44029115 missense possibly damaging 0.77
IGL01843:Cyp2c23 APN 19 44005607 missense probably benign 0.02
IGL02902:Cyp2c23 APN 19 44021558 splice site probably benign
IGL03382:Cyp2c23 APN 19 44014932 missense probably damaging 0.99
R0196:Cyp2c23 UTSW 19 44012356 missense probably damaging 0.98
R0735:Cyp2c23 UTSW 19 44016810 missense probably damaging 1.00
R1384:Cyp2c23 UTSW 19 44013663 missense probably damaging 1.00
R1495:Cyp2c23 UTSW 19 44005508 missense probably benign 0.07
R1809:Cyp2c23 UTSW 19 44021558 splice site probably benign
R1872:Cyp2c23 UTSW 19 44005551 nonsense probably null
R2866:Cyp2c23 UTSW 19 44005446 missense probably damaging 1.00
R3801:Cyp2c23 UTSW 19 44007039 missense probably benign 0.11
R4234:Cyp2c23 UTSW 19 44029165 missense unknown
R4748:Cyp2c23 UTSW 19 44016737 splice site probably null
R4948:Cyp2c23 UTSW 19 44021699 missense possibly damaging 0.49
R5101:Cyp2c23 UTSW 19 44029183 missense unknown
R5420:Cyp2c23 UTSW 19 44015664 critical splice donor site probably null
R5770:Cyp2c23 UTSW 19 44021579 missense probably damaging 0.99
R5993:Cyp2c23 UTSW 19 44012360 missense probably damaging 1.00
R6254:Cyp2c23 UTSW 19 44005463 missense probably benign 0.03
R6269:Cyp2c23 UTSW 19 44029187 start codon destroyed unknown
R6610:Cyp2c23 UTSW 19 44007081 missense probably damaging 1.00
R7344:Cyp2c23 UTSW 19 44021737 splice site probably null
R7603:Cyp2c23 UTSW 19 44014930 missense probably damaging 1.00
R8098:Cyp2c23 UTSW 19 44015803 missense probably benign 0.29
R8157:Cyp2c23 UTSW 19 44021627 missense probably benign 0.00
R8813:Cyp2c23 UTSW 19 44013615 missense probably benign 0.07
X0065:Cyp2c23 UTSW 19 44029171 missense unknown
Predicted Primers PCR Primer
(F):5'- TGAATGTCTCTAGCTAGACTTGG -3'
(R):5'- TAGCAGCAGTAACCCGAGAC -3'

Sequencing Primer
(F):5'- CTTGGGAAGTTAGAACAGTTCGATC -3'
(R):5'- ACAGCCAGGGACTATGTGAGTATTTC -3'
Posted On2020-01-23