Incidental Mutation 'R8055:Fmo4'
ID619298
Institutional Source Beutler Lab
Gene Symbol Fmo4
Ensembl Gene ENSMUSG00000026692
Gene Nameflavin containing monooxygenase 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R8055 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location162793188-162813972 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 162808446 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 46 (T46A)
Ref Sequence ENSEMBL: ENSMUSP00000028014 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028014] [ENSMUST00000111525] [ENSMUST00000140274] [ENSMUST00000144916]
Predicted Effect probably benign
Transcript: ENSMUST00000028014
AA Change: T46A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000028014
Gene: ENSMUSG00000026692
AA Change: T46A

DomainStartEndE-ValueType
Pfam:FMO-like 2 531 9.4e-272 PFAM
Pfam:Pyr_redox_2 4 430 1e-8 PFAM
Pfam:Pyr_redox_3 6 220 5.1e-16 PFAM
Pfam:K_oxygenase 68 227 1.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111525
AA Change: T46A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107150
Gene: ENSMUSG00000026692
AA Change: T46A

DomainStartEndE-ValueType
Pfam:FMO-like 2 531 9.4e-272 PFAM
Pfam:Pyr_redox_2 3 225 1.7e-11 PFAM
Pfam:Pyr_redox_3 6 220 2.5e-9 PFAM
Pfam:K_oxygenase 67 227 6e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140274
AA Change: T46A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000118476
Gene: ENSMUSG00000026692
AA Change: T46A

DomainStartEndE-ValueType
Pfam:FMO-like 2 99 1.5e-57 PFAM
Pfam:NAD_binding_8 7 94 1.6e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144916
SMART Domains Protein: ENSMUSP00000119389
Gene: ENSMUSG00000026692

DomainStartEndE-ValueType
Pfam:FMO-like 1 114 2.6e-63 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Metabolic N-oxidation of diet-derived amino-trimethylamine (TMA) is mediated by flavin-containing monooxygenase and is subject to an inherited FMO3 polymorphism in man. This results in a small subpopulation with reduced TMA N-oxidation capacity and causes fish odor syndrome (Trimethylaminuria). Three forms of the enzyme are encoded by genes clustered in the 1q23-q25 region. Flavin-containing monooxygenases are NADPH-dependent flavoenzymes that catalyzes the oxidation of soft nucleophilic heteroatom centers in drugs, pesticides, and xenobiotics. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahcyl1 A T 3: 107,668,731 D353E probably benign Het
Alk G T 17: 71,899,257 P1033T probably benign Het
Asb15 G T 6: 24,556,566 C20F probably benign Het
BC049715 A G 6: 136,839,915 N51S possibly damaging Het
Ccser1 G A 6: 61,313,773 V480M possibly damaging Het
Cep295 T C 9: 15,333,609 N1184D probably benign Het
Cers6 C T 2: 68,947,281 R111W probably damaging Het
Clybl T A 14: 122,377,861 D204E probably damaging Het
Cxcl13 T C 5: 95,959,904 V73A probably benign Het
Dchs2 A G 3: 83,129,725 N593S probably benign Het
Esco2 A T 14: 65,831,719 N47K probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Gm15217 T C 14: 46,379,454 probably benign Het
Gm9774 C A 3: 92,428,832 G188W unknown Het
Gnb5 G T 9: 75,343,544 A317S probably benign Het
Klf14 A G 6: 30,957,787 V304A probably benign Het
Klrc2 A T 6: 129,656,461 C209* probably null Het
Kmt2a A T 9: 44,821,081 N2646K unknown Het
Krt14 C G 11: 100,204,758 V274L possibly damaging Het
Myo16 A T 8: 10,562,186 D1277V unknown Het
Myo9a A T 9: 59,907,460 E2226D probably damaging Het
Osbpl8 T C 10: 111,284,394 V631A possibly damaging Het
Piezo2 G A 18: 63,042,811 S1833L probably damaging Het
Pkp4 T C 2: 59,308,015 V203A probably benign Het
Primpol T C 8: 46,579,162 D459G probably benign Het
Prkdc G T 16: 15,816,885 R3631S probably benign Het
Rbbp8nl T C 2: 180,278,208 T558A probably benign Het
Rcc2 G A 4: 140,702,275 C40Y probably benign Het
Rdx G A 9: 52,086,424 R566Q probably damaging Het
Rhbdf2 A C 11: 116,607,365 S3A probably benign Het
Rpap1 A T 2: 119,764,803 I1319N probably benign Het
Sbno2 T A 10: 80,069,431 I206F possibly damaging Het
Scn1a A G 2: 66,319,501 V944A probably damaging Het
Scube1 C T 15: 83,659,025 probably null Het
Slc22a20 G A 19: 5,971,411 A521V probably benign Het
Slc6a4 C A 11: 77,010,598 T53K probably benign Het
Snapc2 G A 8: 4,254,322 R75Q probably damaging Het
Sptan1 A T 2: 29,994,339 K662I probably benign Het
Sycp3 T C 10: 88,462,576 S55P probably damaging Het
Tet2 A T 3: 133,467,992 V1503D possibly damaging Het
Tfrc T A 16: 32,618,656 N277K probably benign Het
Tlx3 A T 11: 33,201,283 V291E probably damaging Het
Tnk1 A T 11: 69,856,501 H101Q probably benign Het
Tns3 A T 11: 8,545,343 D70E probably damaging Het
Trip11 C A 12: 101,837,665 G1938C probably damaging Het
Tubg1 T C 11: 101,124,002 L190P probably damaging Het
Vmn2r79 A T 7: 87,037,333 S641C possibly damaging Het
Wnt8b A G 19: 44,493,513 probably benign Het
Other mutations in Fmo4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00933:Fmo4 APN 1 162794023 missense probably benign 0.00
IGL01090:Fmo4 APN 1 162809785 splice site probably null
IGL01295:Fmo4 APN 1 162799124 missense probably damaging 1.00
IGL02089:Fmo4 APN 1 162799080 missense probably benign 0.04
IGL02483:Fmo4 APN 1 162808421 missense possibly damaging 0.60
R0608:Fmo4 UTSW 1 162803651 missense possibly damaging 0.95
R0660:Fmo4 UTSW 1 162809848 missense probably benign 0.05
R0737:Fmo4 UTSW 1 162808392 nonsense probably null
R1117:Fmo4 UTSW 1 162803663 missense probably benign 0.03
R1464:Fmo4 UTSW 1 162794355 missense possibly damaging 0.54
R1464:Fmo4 UTSW 1 162794355 missense possibly damaging 0.54
R1577:Fmo4 UTSW 1 162803700 missense possibly damaging 0.50
R1792:Fmo4 UTSW 1 162794290 missense probably benign
R1875:Fmo4 UTSW 1 162803618 missense possibly damaging 0.95
R1929:Fmo4 UTSW 1 162799047 missense possibly damaging 0.95
R1956:Fmo4 UTSW 1 162803690 missense probably benign 0.01
R1957:Fmo4 UTSW 1 162803690 missense probably benign 0.01
R1958:Fmo4 UTSW 1 162803690 missense probably benign 0.01
R2011:Fmo4 UTSW 1 162798889 missense probably damaging 1.00
R2030:Fmo4 UTSW 1 162794172 missense probably damaging 1.00
R2072:Fmo4 UTSW 1 162809887 missense probably benign 0.20
R2272:Fmo4 UTSW 1 162799047 missense possibly damaging 0.95
R3890:Fmo4 UTSW 1 162794055 missense probably benign 0.39
R4255:Fmo4 UTSW 1 162794326 missense probably benign 0.00
R4273:Fmo4 UTSW 1 162805179 missense probably damaging 0.97
R4760:Fmo4 UTSW 1 162809827 missense probably damaging 1.00
R5445:Fmo4 UTSW 1 162805273 missense probably benign 0.24
R5726:Fmo4 UTSW 1 162808259 critical splice donor site probably null
R5786:Fmo4 UTSW 1 162803717 missense probably benign 0.00
R6391:Fmo4 UTSW 1 162793969 nonsense probably null
R6826:Fmo4 UTSW 1 162803769 missense probably damaging 1.00
R7457:Fmo4 UTSW 1 162794103 missense probably benign 0.00
R7913:Fmo4 UTSW 1 162794172 missense possibly damaging 0.69
R8031:Fmo4 UTSW 1 162798852 nonsense probably null
R8234:Fmo4 UTSW 1 162805188 missense probably damaging 1.00
R8346:Fmo4 UTSW 1 162794223 missense probably benign 0.01
X0020:Fmo4 UTSW 1 162794378 missense probably benign 0.02
Z1177:Fmo4 UTSW 1 162803720 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TATCTCAGCAGGCCAAAGTG -3'
(R):5'- TGGACAAAGAGATTGCATTGAC -3'

Sequencing Primer
(F):5'- GTGCTCAGCAAATTCTCTGAG -3'
(R):5'- GATGTCTTATCCTGGCAACACGG -3'
Posted On2020-01-23