Incidental Mutation 'R8055:Cers6'
ID619302
Institutional Source Beutler Lab
Gene Symbol Cers6
Ensembl Gene ENSMUSG00000027035
Gene Nameceramide synthase 6
Synonymssimilar to TRH1, Lass6, CerS6, T1L, 4732462C07Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.251) question?
Stock #R8055 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location68861441-69114282 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 68947281 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 111 (R111W)
Ref Sequence ENSEMBL: ENSMUSP00000028426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028426] [ENSMUST00000176018]
PDB Structure
Solution structure of the homeobox domain of mouse LAG1 longevity assurance homolog 6 [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000028426
AA Change: R111W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028426
Gene: ENSMUSG00000027035
AA Change: R111W

DomainStartEndE-ValueType
Blast:TLC 10 57 6e-7 BLAST
HOX 73 131 2.92e-2 SMART
TLC 130 331 1.21e-74 SMART
low complexity region 336 353 N/A INTRINSIC
low complexity region 361 373 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176018
AA Change: R111W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135604
Gene: ENSMUSG00000027035
AA Change: R111W

DomainStartEndE-ValueType
Blast:TLC 10 57 7e-7 BLAST
HOX 73 131 2.92e-2 SMART
TLC 130 331 1.21e-74 SMART
low complexity region 344 361 N/A INTRINSIC
low complexity region 369 381 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knockout allele exhibit hind limb clasping, habituation deficit and altered lipid homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahcyl1 A T 3: 107,668,731 D353E probably benign Het
Alk G T 17: 71,899,257 P1033T probably benign Het
Asb15 G T 6: 24,556,566 C20F probably benign Het
BC049715 A G 6: 136,839,915 N51S possibly damaging Het
Ccser1 G A 6: 61,313,773 V480M possibly damaging Het
Cep295 T C 9: 15,333,609 N1184D probably benign Het
Clybl T A 14: 122,377,861 D204E probably damaging Het
Cxcl13 T C 5: 95,959,904 V73A probably benign Het
Dchs2 A G 3: 83,129,725 N593S probably benign Het
Esco2 A T 14: 65,831,719 N47K probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fmo4 T C 1: 162,808,446 T46A probably benign Het
Gm15217 T C 14: 46,379,454 probably benign Het
Gm9774 C A 3: 92,428,832 G188W unknown Het
Gnb5 G T 9: 75,343,544 A317S probably benign Het
Klf14 A G 6: 30,957,787 V304A probably benign Het
Klrc2 A T 6: 129,656,461 C209* probably null Het
Kmt2a A T 9: 44,821,081 N2646K unknown Het
Krt14 C G 11: 100,204,758 V274L possibly damaging Het
Myo16 A T 8: 10,562,186 D1277V unknown Het
Myo9a A T 9: 59,907,460 E2226D probably damaging Het
Osbpl8 T C 10: 111,284,394 V631A possibly damaging Het
Piezo2 G A 18: 63,042,811 S1833L probably damaging Het
Pkp4 T C 2: 59,308,015 V203A probably benign Het
Primpol T C 8: 46,579,162 D459G probably benign Het
Prkdc G T 16: 15,816,885 R3631S probably benign Het
Rbbp8nl T C 2: 180,278,208 T558A probably benign Het
Rcc2 G A 4: 140,702,275 C40Y probably benign Het
Rdx G A 9: 52,086,424 R566Q probably damaging Het
Rhbdf2 A C 11: 116,607,365 S3A probably benign Het
Rpap1 A T 2: 119,764,803 I1319N probably benign Het
Sbno2 T A 10: 80,069,431 I206F possibly damaging Het
Scn1a A G 2: 66,319,501 V944A probably damaging Het
Scube1 C T 15: 83,659,025 probably null Het
Slc22a20 G A 19: 5,971,411 A521V probably benign Het
Slc6a4 C A 11: 77,010,598 T53K probably benign Het
Snapc2 G A 8: 4,254,322 R75Q probably damaging Het
Sptan1 A T 2: 29,994,339 K662I probably benign Het
Sycp3 T C 10: 88,462,576 S55P probably damaging Het
Tet2 A T 3: 133,467,992 V1503D possibly damaging Het
Tfrc T A 16: 32,618,656 N277K probably benign Het
Tlx3 A T 11: 33,201,283 V291E probably damaging Het
Tnk1 A T 11: 69,856,501 H101Q probably benign Het
Tns3 A T 11: 8,545,343 D70E probably damaging Het
Trip11 C A 12: 101,837,665 G1938C probably damaging Het
Tubg1 T C 11: 101,124,002 L190P probably damaging Het
Vmn2r79 A T 7: 87,037,333 S641C possibly damaging Het
Wnt8b A G 19: 44,493,513 probably benign Het
Other mutations in Cers6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02513:Cers6 APN 2 69068669 missense probably benign
IGL02897:Cers6 APN 2 68934533 nonsense probably null
IGL03299:Cers6 APN 2 68861784 missense probably benign 0.17
R0520:Cers6 UTSW 2 69105091 nonsense probably null
R1280:Cers6 UTSW 2 69068689 missense probably benign 0.06
R2497:Cers6 UTSW 2 69071446 splice site probably benign
R4843:Cers6 UTSW 2 69068659 missense probably benign 0.03
R4931:Cers6 UTSW 2 69105112 missense probably damaging 0.98
R5723:Cers6 UTSW 2 69108445 missense probably benign 0.03
R5973:Cers6 UTSW 2 69068625 splice site probably null
R6058:Cers6 UTSW 2 68861664 missense probably benign 0.12
R6453:Cers6 UTSW 2 69047169 missense probably benign 0.00
R6788:Cers6 UTSW 2 69108559 missense possibly damaging 0.95
R7493:Cers6 UTSW 2 68861807 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GAGCGATCTTTGTTCCTGCC -3'
(R):5'- GCCAATATTTGTTGTGTTCCACG -3'

Sequencing Primer
(F):5'- TGGATAGACTAGATTCGCAGTCAC -3'
(R):5'- CCACGTCTGGGTTGGCATAAAG -3'
Posted On2020-01-23