Incidental Mutation 'R0662:Cpsf7'
ID61931
Institutional Source Beutler Lab
Gene Symbol Cpsf7
Ensembl Gene ENSMUSG00000034820
Gene Namecleavage and polyadenylation specific factor 7
SynonymsC330017N18Rik, 5730453I16Rik
MMRRC Submission 038847-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0662 (G1)
Quality Score89
Status Not validated
Chromosome19
Chromosomal Location10525244-10547735 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) T to C at 10526008 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 1 (M1T)
Ref Sequence ENSEMBL: ENSMUSP00000038958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025570] [ENSMUST00000038379]
Predicted Effect probably benign
Transcript: ENSMUST00000025570
SMART Domains Protein: ENSMUSP00000025570
Gene: ENSMUSG00000024668

DomainStartEndE-ValueType
low complexity region 14 25 N/A INTRINSIC
Pfam:Sdh5 65 138 7.6e-27 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000038379
AA Change: M1T

PolyPhen 2 Score 0.771 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000038958
Gene: ENSMUSG00000034820
AA Change: M1T

DomainStartEndE-ValueType
low complexity region 51 63 N/A INTRINSIC
RRM 83 158 7.31e-8 SMART
low complexity region 188 202 N/A INTRINSIC
low complexity region 228 260 N/A INTRINSIC
low complexity region 265 291 N/A INTRINSIC
low complexity region 346 362 N/A INTRINSIC
low complexity region 405 439 N/A INTRINSIC
low complexity region 454 471 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.6%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cleavage factor Im (CFIm) is one of six factors necessary for correct cleavage and polyadenylation of pre-mRNAs. CFIm is composed of three different subunits of 25, 59, and 68 kDa, and it functions as a heterotetramer, with a dimer of the 25 kDa subunit binding to two of the 59 or 68 kDa subunits. The protein encoded by this gene represents the 59 kDa subunit, which can interact with the splicing factor U2 snRNP Auxiliary Factor (U2AF) 65 to link the splicing and polyadenylation complexes. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf T C 19: 31,920,938 S241P probably benign Het
Ankrd53 G T 6: 83,763,643 V83L probably damaging Het
Armcx2 G A X: 134,805,636 T416I possibly damaging Het
C4b G A 17: 34,730,888 R1441C probably damaging Het
Cacng3 T C 7: 122,768,359 I154T probably damaging Het
Cand2 A G 6: 115,787,210 D315G probably benign Het
Celsr2 A T 3: 108,398,520 S2089R probably damaging Het
Chd9 A C 8: 90,977,676 K247Q probably damaging Het
Chil1 A C 1: 134,188,573 S263R probably damaging Het
Clec12b A C 6: 129,376,237 C262W probably damaging Het
Cul3 T C 1: 80,271,565 D597G probably damaging Het
Dcaf11 T C 14: 55,565,507 V251A possibly damaging Het
Eno2 A T 6: 124,763,811 F218I probably damaging Het
Frmd6 A T 12: 70,899,444 R549* probably null Het
Fyb2 G A 4: 104,995,698 S461N possibly damaging Het
Gm5709 A T 3: 59,606,743 noncoding transcript Het
Hormad1 T C 3: 95,575,599 I132T probably benign Het
Itga7 G T 10: 128,953,531 R981L probably damaging Het
Itgbl1 T A 14: 123,827,894 N153K probably damaging Het
Itih1 T C 14: 30,933,360 E626G possibly damaging Het
Kat6b AGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGA 14: 21,662,349 probably benign Het
Kcna2 A T 3: 107,105,401 T433S probably benign Het
Map4k5 A G 12: 69,813,153 V673A probably damaging Het
Mmp27 T A 9: 7,577,650 V281E probably benign Het
Nr2c1 A T 10: 94,190,738 I492F probably damaging Het
Olfr131 A G 17: 38,082,933 I15T probably benign Het
Olfr292 A G 7: 86,694,630 Y58C possibly damaging Het
Olfr457 C T 6: 42,471,774 V135M possibly damaging Het
Olfr703 A T 7: 106,844,649 I13F probably benign Het
Olfr77 G C 9: 19,920,500 C97S probably damaging Het
Olfr862 T C 9: 19,883,952 M118V probably benign Het
Olfr911-ps1 T A 9: 38,524,026 M98K probably damaging Het
Pank3 T C 11: 35,778,650 M237T probably damaging Het
Plekhh1 A G 12: 79,078,993 T1268A probably benign Het
Ptchd4 A G 17: 42,502,576 Y456C probably damaging Het
Rhcg C T 7: 79,599,729 V310M probably damaging Het
Ryr1 A T 7: 29,100,189 D906E probably damaging Het
Sez6l A T 5: 112,473,422 L262Q probably damaging Het
Shprh G A 10: 11,186,847 V1233I probably damaging Het
Slc3a1 A G 17: 85,037,207 E267G possibly damaging Het
Slc5a5 T A 8: 70,883,875 T616S probably benign Het
St5 G T 7: 109,557,426 P39Q probably damaging Het
Syne3 T G 12: 104,961,510 E318A probably benign Het
Tecpr2 A G 12: 110,896,228 T25A probably benign Het
Ubxn1 T A 19: 8,875,197 probably null Het
Unc5b C A 10: 60,772,583 R616L possibly damaging Het
Ush2a A G 1: 188,351,093 T278A probably benign Het
Utp14b A G 1: 78,664,999 T205A probably damaging Het
Vmn1r219 T C 13: 23,163,453 S271P possibly damaging Het
Vmn2r76 C T 7: 86,230,370 V241M probably benign Het
Zbtb24 G A 10: 41,462,279 G429D probably damaging Het
Zdhhc2 T C 8: 40,447,098 S68P probably damaging Het
Zfp719 G A 7: 43,584,254 M32I possibly damaging Het
Zfp975 T C 7: 42,662,526 N221S probably benign Het
Other mutations in Cpsf7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Cpsf7 APN 19 10539787 missense probably damaging 0.98
IGL00870:Cpsf7 APN 19 10539650 splice site probably null
IGL01883:Cpsf7 APN 19 10526023 missense possibly damaging 0.69
IGL02406:Cpsf7 APN 19 10531988 missense probably damaging 0.96
IGL02491:Cpsf7 APN 19 10539637 missense possibly damaging 0.92
IGL02990:Cpsf7 APN 19 10531795 missense probably benign
R0003:Cpsf7 UTSW 19 10539629 missense possibly damaging 0.88
R0540:Cpsf7 UTSW 19 10533318 nonsense probably null
R0633:Cpsf7 UTSW 19 10531782 missense probably benign 0.09
R1309:Cpsf7 UTSW 19 10533467 critical splice donor site probably null
R1817:Cpsf7 UTSW 19 10535439 missense possibly damaging 0.89
R2004:Cpsf7 UTSW 19 10540709 missense probably damaging 1.00
R2286:Cpsf7 UTSW 19 10535296 missense probably damaging 0.99
R2417:Cpsf7 UTSW 19 10525968 start gained probably benign
R4374:Cpsf7 UTSW 19 10539637 missense probably damaging 1.00
R5788:Cpsf7 UTSW 19 10540718 missense possibly damaging 0.88
R5801:Cpsf7 UTSW 19 10539632 missense probably benign 0.02
R6823:Cpsf7 UTSW 19 10532884 nonsense probably null
R7371:Cpsf7 UTSW 19 10531839 missense probably benign 0.00
R7602:Cpsf7 UTSW 19 10535373 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGCTGCGTCTTGGGAGACTAGAG -3'
(R):5'- TTCATGGTACACCATTGGGAGGGG -3'

Sequencing Primer
(F):5'- GAGACTAGAGCTTGTTGACCC -3'
(R):5'- GAATGGTCAGTCGTCTTCAAAGC -3'
Posted On2013-07-30