Incidental Mutation 'R8055:Ccser1'
ID 619313
Institutional Source Beutler Lab
Gene Symbol Ccser1
Ensembl Gene ENSMUSG00000039578
Gene Name coiled-coil serine rich 1
Synonyms 6230405M12Rik, Fam190a, C130092O11Rik
MMRRC Submission 067492-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.169) question?
Stock # R8055 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 61157308-62359849 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 61290757 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 480 (V480M)
Ref Sequence ENSEMBL: ENSMUSP00000040251 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045522] [ENSMUST00000126214]
AlphaFold Q8C0C4
Predicted Effect possibly damaging
Transcript: ENSMUST00000045522
AA Change: V480M

PolyPhen 2 Score 0.468 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000040251
Gene: ENSMUSG00000039578
AA Change: V480M

DomainStartEndE-ValueType
low complexity region 28 36 N/A INTRINSIC
low complexity region 43 61 N/A INTRINSIC
low complexity region 435 446 N/A INTRINSIC
low complexity region 510 525 N/A INTRINSIC
low complexity region 645 659 N/A INTRINSIC
coiled coil region 674 703 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000126214
AA Change: V480M

PolyPhen 2 Score 0.468 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000122894
Gene: ENSMUSG00000039578
AA Change: V480M

DomainStartEndE-ValueType
low complexity region 28 36 N/A INTRINSIC
low complexity region 43 61 N/A INTRINSIC
low complexity region 435 446 N/A INTRINSIC
low complexity region 510 525 N/A INTRINSIC
low complexity region 645 659 N/A INTRINSIC
coiled coil region 674 703 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adrm1b C A 3: 92,336,139 (GRCm39) G188W unknown Het
Ahcyl1 A T 3: 107,576,047 (GRCm39) D353E probably benign Het
Alk G T 17: 72,206,252 (GRCm39) P1033T probably benign Het
Asb15 G T 6: 24,556,565 (GRCm39) C20F probably benign Het
BC049715 A G 6: 136,816,913 (GRCm39) N51S possibly damaging Het
Cep295 T C 9: 15,244,905 (GRCm39) N1184D probably benign Het
Cers6 C T 2: 68,777,625 (GRCm39) R111W probably damaging Het
Clybl T A 14: 122,615,273 (GRCm39) D204E probably damaging Het
Cxcl13 T C 5: 96,107,763 (GRCm39) V73A probably benign Het
Dchs2 A G 3: 83,037,032 (GRCm39) N593S probably benign Het
Esco2 A T 14: 66,069,168 (GRCm39) N47K probably benign Het
Fan1 T A 7: 64,022,234 (GRCm39) N340Y probably damaging Het
Fmo4 T C 1: 162,636,015 (GRCm39) T46A probably benign Het
Gm15217 T C 14: 46,616,911 (GRCm39) probably benign Het
Gnb5 G T 9: 75,250,826 (GRCm39) A317S probably benign Het
Klf14 A G 6: 30,934,722 (GRCm39) V304A probably benign Het
Klrc2 A T 6: 129,633,424 (GRCm39) C209* probably null Het
Kmt2a A T 9: 44,732,378 (GRCm39) N2646K unknown Het
Krt14 C G 11: 100,095,584 (GRCm39) V274L possibly damaging Het
Myo16 A T 8: 10,612,186 (GRCm39) D1277V unknown Het
Myo9a A T 9: 59,814,743 (GRCm39) E2226D probably damaging Het
Osbpl8 T C 10: 111,120,255 (GRCm39) V631A possibly damaging Het
Piezo2 G A 18: 63,175,882 (GRCm39) S1833L probably damaging Het
Pkp4 T C 2: 59,138,359 (GRCm39) V203A probably benign Het
Primpol T C 8: 47,032,197 (GRCm39) D459G probably benign Het
Prkdc G T 16: 15,634,749 (GRCm39) R3631S probably benign Het
Rbbp8nl T C 2: 179,920,001 (GRCm39) T558A probably benign Het
Rcc2 G A 4: 140,429,586 (GRCm39) C40Y probably benign Het
Rdx G A 9: 51,997,724 (GRCm39) R566Q probably damaging Het
Rhbdf2 A C 11: 116,498,191 (GRCm39) S3A probably benign Het
Rpap1 A T 2: 119,595,284 (GRCm39) I1319N probably benign Het
Sbno2 T A 10: 79,905,265 (GRCm39) I206F possibly damaging Het
Scn1a A G 2: 66,149,845 (GRCm39) V944A probably damaging Het
Scube1 C T 15: 83,543,226 (GRCm39) probably null Het
Slc22a20 G A 19: 6,021,439 (GRCm39) A521V probably benign Het
Slc6a4 C A 11: 76,901,424 (GRCm39) T53K probably benign Het
Snapc2 G A 8: 4,304,322 (GRCm39) R75Q probably damaging Het
Sptan1 A T 2: 29,884,351 (GRCm39) K662I probably benign Het
Sycp3 T C 10: 88,298,438 (GRCm39) S55P probably damaging Het
Tet2 A T 3: 133,173,753 (GRCm39) V1503D possibly damaging Het
Tfrc T A 16: 32,437,474 (GRCm39) N277K probably benign Het
Tlx3 A T 11: 33,151,283 (GRCm39) V291E probably damaging Het
Tnk1 A T 11: 69,747,327 (GRCm39) H101Q probably benign Het
Tns3 A T 11: 8,495,343 (GRCm39) D70E probably damaging Het
Trip11 C A 12: 101,803,924 (GRCm39) G1938C probably damaging Het
Tubg1 T C 11: 101,014,828 (GRCm39) L190P probably damaging Het
Vmn2r79 A T 7: 86,686,541 (GRCm39) S641C possibly damaging Het
Wnt8b A G 19: 44,481,952 (GRCm39) probably benign Het
Other mutations in Ccser1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Ccser1 APN 6 62,357,126 (GRCm39) missense possibly damaging 0.80
IGL00858:Ccser1 APN 6 61,787,649 (GRCm39) nonsense probably null
IGL01012:Ccser1 APN 6 61,615,474 (GRCm39) missense probably benign 0.01
IGL01391:Ccser1 APN 6 61,615,505 (GRCm39) splice site probably benign
IGL01643:Ccser1 APN 6 61,288,839 (GRCm39) missense probably benign 0.01
IGL01767:Ccser1 APN 6 61,695,136 (GRCm39) missense probably benign 0.03
IGL02081:Ccser1 APN 6 61,288,152 (GRCm39) nonsense probably null
IGL02152:Ccser1 APN 6 61,288,692 (GRCm39) missense possibly damaging 0.57
IGL02870:Ccser1 APN 6 61,288,276 (GRCm39) missense probably damaging 0.99
IGL02890:Ccser1 APN 6 62,356,815 (GRCm39) missense probably damaging 0.99
IGL03147:Ccser1 UTSW 6 61,289,144 (GRCm39) missense probably benign 0.02
R0020:Ccser1 UTSW 6 61,290,788 (GRCm39) missense possibly damaging 0.62
R0831:Ccser1 UTSW 6 61,400,045 (GRCm39) missense probably damaging 0.99
R1306:Ccser1 UTSW 6 62,357,090 (GRCm39) missense probably damaging 0.99
R1441:Ccser1 UTSW 6 62,357,016 (GRCm39) missense probably benign 0.00
R1650:Ccser1 UTSW 6 61,615,474 (GRCm39) missense probably benign 0.01
R1653:Ccser1 UTSW 6 61,288,449 (GRCm39) missense probably benign 0.00
R1913:Ccser1 UTSW 6 62,356,878 (GRCm39) missense probably damaging 0.99
R1961:Ccser1 UTSW 6 61,290,630 (GRCm39) splice site probably benign
R2030:Ccser1 UTSW 6 61,288,547 (GRCm39) missense probably benign
R2056:Ccser1 UTSW 6 61,399,936 (GRCm39) splice site probably null
R2268:Ccser1 UTSW 6 61,547,827 (GRCm39) missense probably damaging 1.00
R2280:Ccser1 UTSW 6 61,547,799 (GRCm39) missense probably damaging 1.00
R2281:Ccser1 UTSW 6 61,547,799 (GRCm39) missense probably damaging 1.00
R2571:Ccser1 UTSW 6 61,399,944 (GRCm39) missense probably damaging 1.00
R4606:Ccser1 UTSW 6 61,288,568 (GRCm39) missense probably damaging 0.99
R4711:Ccser1 UTSW 6 61,288,910 (GRCm39) missense possibly damaging 0.74
R4770:Ccser1 UTSW 6 61,288,485 (GRCm39) missense possibly damaging 0.85
R4932:Ccser1 UTSW 6 61,695,175 (GRCm39) missense possibly damaging 0.78
R5078:Ccser1 UTSW 6 61,288,350 (GRCm39) missense probably damaging 0.97
R5097:Ccser1 UTSW 6 61,289,144 (GRCm39) missense probably benign 0.02
R5221:Ccser1 UTSW 6 61,289,075 (GRCm39) missense probably damaging 0.99
R5378:Ccser1 UTSW 6 61,288,650 (GRCm39) missense probably benign 0.00
R5604:Ccser1 UTSW 6 61,290,788 (GRCm39) missense probably damaging 0.97
R5700:Ccser1 UTSW 6 61,288,260 (GRCm39) missense probably benign 0.00
R5970:Ccser1 UTSW 6 61,288,226 (GRCm39) missense possibly damaging 0.94
R6257:Ccser1 UTSW 6 62,356,769 (GRCm39) missense probably benign
R6257:Ccser1 UTSW 6 61,350,946 (GRCm39) missense probably damaging 0.96
R6375:Ccser1 UTSW 6 61,288,152 (GRCm39) nonsense probably null
R6703:Ccser1 UTSW 6 61,615,495 (GRCm39) nonsense probably null
R6930:Ccser1 UTSW 6 62,357,009 (GRCm39) missense probably benign 0.03
R7256:Ccser1 UTSW 6 61,288,851 (GRCm39) missense probably benign 0.38
R7362:Ccser1 UTSW 6 61,787,864 (GRCm39) missense unknown
R7508:Ccser1 UTSW 6 61,547,707 (GRCm39) missense probably benign 0.05
R7532:Ccser1 UTSW 6 62,356,915 (GRCm39) nonsense probably null
R7533:Ccser1 UTSW 6 61,615,474 (GRCm39) missense probably benign 0.25
R7729:Ccser1 UTSW 6 61,288,840 (GRCm39) missense probably benign
R7875:Ccser1 UTSW 6 61,288,932 (GRCm39) missense probably benign 0.06
R8396:Ccser1 UTSW 6 61,289,088 (GRCm39) missense probably benign 0.09
R8724:Ccser1 UTSW 6 61,288,199 (GRCm39) missense probably damaging 0.99
R8849:Ccser1 UTSW 6 61,288,537 (GRCm39) missense probably benign 0.00
R8906:Ccser1 UTSW 6 61,787,842 (GRCm39) missense probably benign 0.00
R9058:Ccser1 UTSW 6 61,350,976 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCGAGACCTTTTGAATCATTCTAG -3'
(R):5'- TCGACTACGGAAACCACTTTTC -3'

Sequencing Primer
(F):5'- TCAGTCCATACCGAGAAG -3'
(R):5'- GAAACCACTTTTCCATTGACCCTATG -3'
Posted On 2020-01-23