Incidental Mutation 'R8055:Sbno2'
ID619326
Institutional Source Beutler Lab
Gene Symbol Sbno2
Ensembl Gene ENSMUSG00000035673
Gene Namestrawberry notch 2
SynonymsStno
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.395) question?
Stock #R8055 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location80056992-80105571 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 80069431 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 206 (I206F)
Ref Sequence ENSEMBL: ENSMUSP00000151854 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042771] [ENSMUST00000217972] [ENSMUST00000218630] [ENSMUST00000219258] [ENSMUST00000219260]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042771
AA Change: I206F

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000041635
Gene: ENSMUSG00000035673
AA Change: I206F

DomainStartEndE-ValueType
low complexity region 96 112 N/A INTRINSIC
low complexity region 177 189 N/A INTRINSIC
Pfam:AAA_34 209 500 8.2e-135 PFAM
Pfam:ResIII 239 419 7.7e-8 PFAM
low complexity region 611 631 N/A INTRINSIC
Pfam:Helicase_C_4 726 1004 7.5e-120 PFAM
low complexity region 1263 1283 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000217972
AA Change: I190F

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000218630
AA Change: I206F

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000219258
Predicted Effect possibly damaging
Transcript: ENSMUST00000219260
AA Change: I206F

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired osteoclast fusion, impaired osteoblastogenesis, osteopetrosis, increased bone mass, and decreased body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahcyl1 A T 3: 107,668,731 D353E probably benign Het
Alk G T 17: 71,899,257 P1033T probably benign Het
Asb15 G T 6: 24,556,566 C20F probably benign Het
BC049715 A G 6: 136,839,915 N51S possibly damaging Het
Ccser1 G A 6: 61,313,773 V480M possibly damaging Het
Cep295 T C 9: 15,333,609 N1184D probably benign Het
Cers6 C T 2: 68,947,281 R111W probably damaging Het
Clybl T A 14: 122,377,861 D204E probably damaging Het
Cxcl13 T C 5: 95,959,904 V73A probably benign Het
Dchs2 A G 3: 83,129,725 N593S probably benign Het
Esco2 A T 14: 65,831,719 N47K probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fmo4 T C 1: 162,808,446 T46A probably benign Het
Gm15217 T C 14: 46,379,454 probably benign Het
Gm9774 C A 3: 92,428,832 G188W unknown Het
Gnb5 G T 9: 75,343,544 A317S probably benign Het
Klf14 A G 6: 30,957,787 V304A probably benign Het
Klrc2 A T 6: 129,656,461 C209* probably null Het
Kmt2a A T 9: 44,821,081 N2646K unknown Het
Krt14 C G 11: 100,204,758 V274L possibly damaging Het
Myo16 A T 8: 10,562,186 D1277V unknown Het
Myo9a A T 9: 59,907,460 E2226D probably damaging Het
Osbpl8 T C 10: 111,284,394 V631A possibly damaging Het
Piezo2 G A 18: 63,042,811 S1833L probably damaging Het
Pkp4 T C 2: 59,308,015 V203A probably benign Het
Primpol T C 8: 46,579,162 D459G probably benign Het
Prkdc G T 16: 15,816,885 R3631S probably benign Het
Rbbp8nl T C 2: 180,278,208 T558A probably benign Het
Rcc2 G A 4: 140,702,275 C40Y probably benign Het
Rdx G A 9: 52,086,424 R566Q probably damaging Het
Rhbdf2 A C 11: 116,607,365 S3A probably benign Het
Rpap1 A T 2: 119,764,803 I1319N probably benign Het
Scn1a A G 2: 66,319,501 V944A probably damaging Het
Scube1 C T 15: 83,659,025 probably null Het
Slc22a20 G A 19: 5,971,411 A521V probably benign Het
Slc6a4 C A 11: 77,010,598 T53K probably benign Het
Snapc2 G A 8: 4,254,322 R75Q probably damaging Het
Sptan1 A T 2: 29,994,339 K662I probably benign Het
Sycp3 T C 10: 88,462,576 S55P probably damaging Het
Tet2 A T 3: 133,467,992 V1503D possibly damaging Het
Tfrc T A 16: 32,618,656 N277K probably benign Het
Tlx3 A T 11: 33,201,283 V291E probably damaging Het
Tnk1 A T 11: 69,856,501 H101Q probably benign Het
Tns3 A T 11: 8,545,343 D70E probably damaging Het
Trip11 C A 12: 101,837,665 G1938C probably damaging Het
Tubg1 T C 11: 101,124,002 L190P probably damaging Het
Vmn2r79 A T 7: 87,037,333 S641C possibly damaging Het
Wnt8b A G 19: 44,493,513 probably benign Het
Other mutations in Sbno2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Sbno2 APN 10 80064506 splice site probably benign
IGL01773:Sbno2 APN 10 80057831 missense probably damaging 1.00
IGL01869:Sbno2 APN 10 80060392 critical splice donor site probably null
IGL01911:Sbno2 APN 10 80069624 nonsense probably null
IGL02071:Sbno2 APN 10 80060641 missense probably damaging 1.00
IGL02094:Sbno2 APN 10 80057645 missense probably benign
IGL02220:Sbno2 APN 10 80072368 missense probably benign 0.04
IGL02366:Sbno2 APN 10 80064202 missense probably damaging 1.00
IGL02608:Sbno2 APN 10 80067402 splice site probably null
IGL03007:Sbno2 APN 10 80058550 splice site probably benign
IGL03083:Sbno2 APN 10 80057534 missense probably damaging 0.98
IGL03393:Sbno2 APN 10 80066901 missense probably damaging 1.00
R0034:Sbno2 UTSW 10 80058340 splice site probably benign
R0126:Sbno2 UTSW 10 80068853 splice site probably null
R0652:Sbno2 UTSW 10 80067294 missense probably damaging 1.00
R0964:Sbno2 UTSW 10 80084259 missense possibly damaging 0.75
R1571:Sbno2 UTSW 10 80060392 critical splice donor site probably null
R1601:Sbno2 UTSW 10 80060492 missense probably damaging 0.98
R1634:Sbno2 UTSW 10 80060634 missense possibly damaging 0.73
R1733:Sbno2 UTSW 10 80058508 missense possibly damaging 0.92
R1762:Sbno2 UTSW 10 80066606 missense probably damaging 1.00
R1832:Sbno2 UTSW 10 80060605 nonsense probably null
R1859:Sbno2 UTSW 10 80058639 nonsense probably null
R2086:Sbno2 UTSW 10 80057856 missense possibly damaging 0.89
R2136:Sbno2 UTSW 10 80062693 missense probably damaging 1.00
R2360:Sbno2 UTSW 10 80058021 missense possibly damaging 0.81
R4426:Sbno2 UTSW 10 80072358 missense probably null 0.02
R4504:Sbno2 UTSW 10 80060492 missense possibly damaging 0.46
R4692:Sbno2 UTSW 10 80086327 missense possibly damaging 0.90
R5044:Sbno2 UTSW 10 80062188 missense probably benign 0.11
R5166:Sbno2 UTSW 10 80066928 nonsense probably null
R5576:Sbno2 UTSW 10 80067337 missense probably damaging 0.99
R5665:Sbno2 UTSW 10 80058453 missense probably benign 0.00
R5709:Sbno2 UTSW 10 80086337 start codon destroyed probably null 0.89
R5828:Sbno2 UTSW 10 80066590 missense possibly damaging 0.84
R6192:Sbno2 UTSW 10 80060016 missense probably damaging 0.99
R6971:Sbno2 UTSW 10 80060034 missense possibly damaging 0.95
R7012:Sbno2 UTSW 10 80069518 intron probably benign
R7082:Sbno2 UTSW 10 80060090 splice site probably null
R7133:Sbno2 UTSW 10 80086312 missense probably damaging 1.00
R7438:Sbno2 UTSW 10 80069575 missense unknown
R7481:Sbno2 UTSW 10 80057499 missense probably benign 0.11
R7746:Sbno2 UTSW 10 80058874 missense probably damaging 0.99
R7964:Sbno2 UTSW 10 80068351 missense probably damaging 1.00
R8221:Sbno2 UTSW 10 80070011 missense probably benign
R8329:Sbno2 UTSW 10 80064387 missense probably damaging 1.00
X0026:Sbno2 UTSW 10 80057459 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- GCTGTGGTGAGCATGAACAG -3'
(R):5'- CTAAGTGTAAGTGTCTGGGCCAG -3'

Sequencing Primer
(F):5'- ACCCTCCTTATGAGCTGGG -3'
(R):5'- AAGTGTCTGGGCCAGGGATG -3'
Posted On2020-01-23