Incidental Mutation 'R8055:Tlx3'
ID 619330
Institutional Source Beutler Lab
Gene Symbol Tlx3
Ensembl Gene ENSMUSG00000040610
Gene Name T cell leukemia, homeobox 3
Synonyms Hox11l2, Rnx, Tlx1l2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8055 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 33200752-33203589 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 33201283 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 291 (V291E)
Ref Sequence ENSEMBL: ENSMUSP00000047457 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037746]
AlphaFold O55144
Predicted Effect probably damaging
Transcript: ENSMUST00000037746
AA Change: V291E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000047457
Gene: ENSMUSG00000040610
AA Change: V291E

DomainStartEndE-ValueType
low complexity region 45 53 N/A INTRINSIC
low complexity region 95 115 N/A INTRINSIC
HOX 166 228 1.37e-24 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an orphan homeobox protein that encodes a DNA-binding nuclear transcription factor. A translocation [t(5;14)(q35;q32)] involving this gene is associated with T-cell acute lymphoblastic leukemia (T-ALL) in children and young adults. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous null mice die within 1 day of birth due to a central respiratory failure that resembles human congenital central hypoventilation syndrome. Mice homozygous for an ENU-induced allele exhibit uncoordinated movements. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahcyl1 A T 3: 107,668,731 D353E probably benign Het
Alk G T 17: 71,899,257 P1033T probably benign Het
Asb15 G T 6: 24,556,566 C20F probably benign Het
BC049715 A G 6: 136,839,915 N51S possibly damaging Het
Ccser1 G A 6: 61,313,773 V480M possibly damaging Het
Cep295 T C 9: 15,333,609 N1184D probably benign Het
Cers6 C T 2: 68,947,281 R111W probably damaging Het
Clybl T A 14: 122,377,861 D204E probably damaging Het
Cxcl13 T C 5: 95,959,904 V73A probably benign Het
Dchs2 A G 3: 83,129,725 N593S probably benign Het
Esco2 A T 14: 65,831,719 N47K probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fmo4 T C 1: 162,808,446 T46A probably benign Het
Gm15217 T C 14: 46,379,454 probably benign Het
Gm9774 C A 3: 92,428,832 G188W unknown Het
Gnb5 G T 9: 75,343,544 A317S probably benign Het
Klf14 A G 6: 30,957,787 V304A probably benign Het
Klrc2 A T 6: 129,656,461 C209* probably null Het
Kmt2a A T 9: 44,821,081 N2646K unknown Het
Krt14 C G 11: 100,204,758 V274L possibly damaging Het
Myo16 A T 8: 10,562,186 D1277V unknown Het
Myo9a A T 9: 59,907,460 E2226D probably damaging Het
Osbpl8 T C 10: 111,284,394 V631A possibly damaging Het
Piezo2 G A 18: 63,042,811 S1833L probably damaging Het
Pkp4 T C 2: 59,308,015 V203A probably benign Het
Primpol T C 8: 46,579,162 D459G probably benign Het
Prkdc G T 16: 15,816,885 R3631S probably benign Het
Rbbp8nl T C 2: 180,278,208 T558A probably benign Het
Rcc2 G A 4: 140,702,275 C40Y probably benign Het
Rdx G A 9: 52,086,424 R566Q probably damaging Het
Rhbdf2 A C 11: 116,607,365 S3A probably benign Het
Rpap1 A T 2: 119,764,803 I1319N probably benign Het
Sbno2 T A 10: 80,069,431 I206F possibly damaging Het
Scn1a A G 2: 66,319,501 V944A probably damaging Het
Scube1 C T 15: 83,659,025 probably null Het
Slc22a20 G A 19: 5,971,411 A521V probably benign Het
Slc6a4 C A 11: 77,010,598 T53K probably benign Het
Snapc2 G A 8: 4,254,322 R75Q probably damaging Het
Sptan1 A T 2: 29,994,339 K662I probably benign Het
Sycp3 T C 10: 88,462,576 S55P probably damaging Het
Tet2 A T 3: 133,467,992 V1503D possibly damaging Het
Tfrc T A 16: 32,618,656 N277K probably benign Het
Tnk1 A T 11: 69,856,501 H101Q probably benign Het
Tns3 A T 11: 8,545,343 D70E probably damaging Het
Trip11 C A 12: 101,837,665 G1938C probably damaging Het
Tubg1 T C 11: 101,124,002 L190P probably damaging Het
Vmn2r79 A T 7: 87,037,333 S641C possibly damaging Het
Wnt8b A G 19: 44,493,513 probably benign Het
Other mutations in Tlx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
BB007:Tlx3 UTSW 11 33203058 missense probably damaging 0.99
BB017:Tlx3 UTSW 11 33203058 missense probably damaging 0.99
R0866:Tlx3 UTSW 11 33203315 missense probably damaging 0.99
R1899:Tlx3 UTSW 11 33203072 missense probably benign 0.30
R6228:Tlx3 UTSW 11 33202432 missense probably benign 0.13
R6342:Tlx3 UTSW 11 33202567 missense possibly damaging 0.67
R7067:Tlx3 UTSW 11 33203204 missense probably damaging 1.00
R7290:Tlx3 UTSW 11 33203514 start gained probably benign
R7930:Tlx3 UTSW 11 33203058 missense probably damaging 0.99
Z1176:Tlx3 UTSW 11 33203261 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- AAGGCGCTTCTTTGTCAGGC -3'
(R):5'- ACAAAATCCGGGTGTGCAGG -3'

Sequencing Primer
(F):5'- CTTGGATTGTGCAGCCGC -3'
(R):5'- TAGCAAACCCCAGTGCGTG -3'
Posted On 2020-01-23