Incidental Mutation 'R8055:Trip11'
ID619336
Institutional Source Beutler Lab
Gene Symbol Trip11
Ensembl Gene ENSMUSG00000021188
Gene Namethyroid hormone receptor interactor 11
SynonymsGMAP-210, 3110031G15Rik, 2610511G22Rik, 6030460N08Rik, TRIP230
MMRRC Submission
Accession Numbers

Genbank: NM_028446.1; Ensembl: ENSMUST00000021605, ENSMUST00000085086, ENSMUST00000110038

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8055 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location101834043-101913267 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 101837665 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 1938 (G1938C)
Ref Sequence ENSEMBL: ENSMUSP00000021605 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021605] [ENSMUST00000177183]
Predicted Effect probably damaging
Transcript: ENSMUST00000021605
AA Change: G1938C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021605
Gene: ENSMUSG00000021188
AA Change: G1938C

DomainStartEndE-ValueType
low complexity region 2 26 N/A INTRINSIC
coiled coil region 54 130 N/A INTRINSIC
coiled coil region 167 194 N/A INTRINSIC
coiled coil region 218 702 N/A INTRINSIC
coiled coil region 754 990 N/A INTRINSIC
coiled coil region 1022 1051 N/A INTRINSIC
coiled coil region 1196 1261 N/A INTRINSIC
low complexity region 1310 1322 N/A INTRINSIC
coiled coil region 1336 1481 N/A INTRINSIC
coiled coil region 1547 1657 N/A INTRINSIC
coiled coil region 1681 1771 N/A INTRINSIC
low complexity region 1934 1945 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000177183
AA Change: G1653C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000134976
Gene: ENSMUSG00000021188
AA Change: G1653C

DomainStartEndE-ValueType
coiled coil region 33 158 N/A INTRINSIC
coiled coil region 179 417 N/A INTRINSIC
coiled coil region 469 705 N/A INTRINSIC
coiled coil region 737 766 N/A INTRINSIC
coiled coil region 911 976 N/A INTRINSIC
low complexity region 1025 1037 N/A INTRINSIC
coiled coil region 1051 1196 N/A INTRINSIC
coiled coil region 1262 1372 N/A INTRINSIC
coiled coil region 1396 1486 N/A INTRINSIC
low complexity region 1649 1660 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified based on the interaction of its protein product with thyroid hormone receptor beta. This protein is associated with the Golgi apparatus. The N-terminal region of the protein binds Golgi membranes and the C-terminal region binds the minus ends of microtubules; thus, the protein is thought to play a role in assembly and maintenance of the Golgi ribbon structure around the centrosome. Mutations in this gene cause achondrogenesis type IA.[provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality associated with small size, lung hypoplasia, omphalocele, and ventricular septal defects. [provided by MGI curators]
Allele List at MGI

All alleles(12) : Gene trapped(11) Chemically induced(1)

Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahcyl1 A T 3: 107,668,731 D353E probably benign Het
Alk G T 17: 71,899,257 P1033T probably benign Het
Asb15 G T 6: 24,556,566 C20F probably benign Het
BC049715 A G 6: 136,839,915 N51S possibly damaging Het
Ccser1 G A 6: 61,313,773 V480M possibly damaging Het
Cep295 T C 9: 15,333,609 N1184D probably benign Het
Cers6 C T 2: 68,947,281 R111W probably damaging Het
Clybl T A 14: 122,377,861 D204E probably damaging Het
Cxcl13 T C 5: 95,959,904 V73A probably benign Het
Dchs2 A G 3: 83,129,725 N593S probably benign Het
Esco2 A T 14: 65,831,719 N47K probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fmo4 T C 1: 162,808,446 T46A probably benign Het
Gm15217 T C 14: 46,379,454 probably benign Het
Gm9774 C A 3: 92,428,832 G188W unknown Het
Gnb5 G T 9: 75,343,544 A317S probably benign Het
Klf14 A G 6: 30,957,787 V304A probably benign Het
Klrc2 A T 6: 129,656,461 C209* probably null Het
Kmt2a A T 9: 44,821,081 N2646K unknown Het
Krt14 C G 11: 100,204,758 V274L possibly damaging Het
Myo16 A T 8: 10,562,186 D1277V unknown Het
Myo9a A T 9: 59,907,460 E2226D probably damaging Het
Osbpl8 T C 10: 111,284,394 V631A possibly damaging Het
Piezo2 G A 18: 63,042,811 S1833L probably damaging Het
Pkp4 T C 2: 59,308,015 V203A probably benign Het
Primpol T C 8: 46,579,162 D459G probably benign Het
Prkdc G T 16: 15,816,885 R3631S probably benign Het
Rbbp8nl T C 2: 180,278,208 T558A probably benign Het
Rcc2 G A 4: 140,702,275 C40Y probably benign Het
Rdx G A 9: 52,086,424 R566Q probably damaging Het
Rhbdf2 A C 11: 116,607,365 S3A probably benign Het
Rpap1 A T 2: 119,764,803 I1319N probably benign Het
Sbno2 T A 10: 80,069,431 I206F possibly damaging Het
Scn1a A G 2: 66,319,501 V944A probably damaging Het
Scube1 C T 15: 83,659,025 probably null Het
Slc22a20 G A 19: 5,971,411 A521V probably benign Het
Slc6a4 C A 11: 77,010,598 T53K probably benign Het
Snapc2 G A 8: 4,254,322 R75Q probably damaging Het
Sptan1 A T 2: 29,994,339 K662I probably benign Het
Sycp3 T C 10: 88,462,576 S55P probably damaging Het
Tet2 A T 3: 133,467,992 V1503D possibly damaging Het
Tfrc T A 16: 32,618,656 N277K probably benign Het
Tlx3 A T 11: 33,201,283 V291E probably damaging Het
Tnk1 A T 11: 69,856,501 H101Q probably benign Het
Tns3 A T 11: 8,545,343 D70E probably damaging Het
Tubg1 T C 11: 101,124,002 L190P probably damaging Het
Vmn2r79 A T 7: 87,037,333 S641C possibly damaging Het
Wnt8b A G 19: 44,493,513 probably benign Het
Other mutations in Trip11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Trip11 APN 12 101886147 missense probably benign 0.37
IGL00484:Trip11 APN 12 101885311 nonsense probably null
IGL00972:Trip11 APN 12 101894337 missense probably null 1.00
IGL01476:Trip11 APN 12 101898911 missense probably damaging 0.96
IGL01591:Trip11 APN 12 101883345 missense probably damaging 0.98
IGL01667:Trip11 APN 12 101878862 missense probably damaging 1.00
IGL01764:Trip11 APN 12 101884631 missense probably damaging 1.00
IGL01789:Trip11 APN 12 101871831 missense probably benign 0.05
IGL01814:Trip11 APN 12 101884488 missense probably damaging 0.98
IGL01898:Trip11 APN 12 101885676 missense probably benign
IGL01924:Trip11 APN 12 101886884 missense possibly damaging 0.93
IGL02020:Trip11 APN 12 101884313 missense probably damaging 1.00
IGL02475:Trip11 APN 12 101895683 missense probably benign 0.01
IGL02544:Trip11 APN 12 101893521 missense probably damaging 1.00
IGL02678:Trip11 APN 12 101883390 missense probably damaging 0.96
IGL02714:Trip11 APN 12 101884001 missense probably damaging 1.00
IGL02718:Trip11 APN 12 101886025 missense probably benign 0.24
IGL02904:Trip11 APN 12 101886838 missense probably damaging 1.00
IGL03012:Trip11 APN 12 101883936 missense probably damaging 1.00
IGL03191:Trip11 APN 12 101898925 missense probably damaging 1.00
IGL03327:Trip11 APN 12 101883418 missense possibly damaging 0.87
IGL03337:Trip11 APN 12 101885019 missense probably damaging 1.00
NA:Trip11 UTSW 12 101894321 splice site probably null
R0027:Trip11 UTSW 12 101885169 missense probably benign 0.00
R0028:Trip11 UTSW 12 101884757 missense probably damaging 1.00
R0238:Trip11 UTSW 12 101884728 missense probably damaging 1.00
R0238:Trip11 UTSW 12 101884728 missense probably damaging 1.00
R0239:Trip11 UTSW 12 101884728 missense probably damaging 1.00
R0239:Trip11 UTSW 12 101884728 missense probably damaging 1.00
R0505:Trip11 UTSW 12 101885672 missense probably damaging 0.98
R0556:Trip11 UTSW 12 101884518 nonsense probably null
R0573:Trip11 UTSW 12 101886860 missense probably benign 0.02
R0626:Trip11 UTSW 12 101885976 missense possibly damaging 0.54
R1519:Trip11 UTSW 12 101886160 missense probably benign 0.04
R1530:Trip11 UTSW 12 101912767 missense unknown
R1647:Trip11 UTSW 12 101884392 nonsense probably null
R1648:Trip11 UTSW 12 101884392 nonsense probably null
R1856:Trip11 UTSW 12 101883333 nonsense probably null
R2013:Trip11 UTSW 12 101837722 missense probably damaging 1.00
R2017:Trip11 UTSW 12 101885360 missense probably benign 0.00
R2206:Trip11 UTSW 12 101873442 missense probably benign 0.25
R2207:Trip11 UTSW 12 101873442 missense probably benign 0.25
R2304:Trip11 UTSW 12 101898977 missense possibly damaging 0.58
R2328:Trip11 UTSW 12 101878827 makesense probably null
R2513:Trip11 UTSW 12 101837727 missense possibly damaging 0.94
R3499:Trip11 UTSW 12 101893694 missense possibly damaging 0.87
R4105:Trip11 UTSW 12 101894322 nonsense probably null
R4124:Trip11 UTSW 12 101895698 nonsense probably null
R4126:Trip11 UTSW 12 101895698 nonsense probably null
R4128:Trip11 UTSW 12 101895698 nonsense probably null
R4175:Trip11 UTSW 12 101895698 nonsense probably null
R4176:Trip11 UTSW 12 101895698 nonsense probably null
R4181:Trip11 UTSW 12 101893768 missense probably damaging 1.00
R4296:Trip11 UTSW 12 101885868 nonsense probably null
R4302:Trip11 UTSW 12 101893768 missense probably damaging 1.00
R4306:Trip11 UTSW 12 101886939 missense probably benign
R4342:Trip11 UTSW 12 101884316 missense probably damaging 1.00
R4576:Trip11 UTSW 12 101886240 nonsense probably null
R4586:Trip11 UTSW 12 101883341 missense possibly damaging 0.55
R4634:Trip11 UTSW 12 101837616 missense probably damaging 1.00
R4696:Trip11 UTSW 12 101885290 missense possibly damaging 0.71
R4792:Trip11 UTSW 12 101885446 missense probably benign 0.10
R4903:Trip11 UTSW 12 101886806 critical splice donor site probably null
R5001:Trip11 UTSW 12 101884910 nonsense probably null
R5017:Trip11 UTSW 12 101846620 missense probably benign 0.00
R5227:Trip11 UTSW 12 101884920 missense probably damaging 1.00
R5231:Trip11 UTSW 12 101885601 missense probably damaging 0.96
R5539:Trip11 UTSW 12 101885127 missense probably damaging 0.98
R5754:Trip11 UTSW 12 101885665 nonsense probably null
R5755:Trip11 UTSW 12 101885665 nonsense probably null
R5890:Trip11 UTSW 12 101885972 missense probably damaging 0.99
R5910:Trip11 UTSW 12 101883479 missense probably damaging 1.00
R6083:Trip11 UTSW 12 101889742 missense probably benign 0.00
R6208:Trip11 UTSW 12 101898895 missense probably damaging 1.00
R6216:Trip11 UTSW 12 101890600 missense probably benign 0.31
R6315:Trip11 UTSW 12 101885578 missense possibly damaging 0.84
R6413:Trip11 UTSW 12 101885531 missense probably benign 0.12
R6590:Trip11 UTSW 12 101885451 missense possibly damaging 0.92
R6690:Trip11 UTSW 12 101885451 missense possibly damaging 0.92
R6914:Trip11 UTSW 12 101846620 missense probably benign 0.00
R6938:Trip11 UTSW 12 101837627 missense probably damaging 0.98
R7015:Trip11 UTSW 12 101893683 missense probably damaging 1.00
R7023:Trip11 UTSW 12 101885867 missense probably benign 0.13
R7133:Trip11 UTSW 12 101884070 missense probably damaging 0.97
R7271:Trip11 UTSW 12 101884352 missense probably damaging 1.00
R7424:Trip11 UTSW 12 101885198 missense probably damaging 1.00
R7431:Trip11 UTSW 12 101884019 missense possibly damaging 0.84
R7472:Trip11 UTSW 12 101885380 missense probably benign 0.00
R7491:Trip11 UTSW 12 101885435 missense probably damaging 1.00
R7752:Trip11 UTSW 12 101886974 missense probably benign 0.01
R7763:Trip11 UTSW 12 101844855 missense probably benign 0.03
R7779:Trip11 UTSW 12 101883537 missense probably damaging 0.97
R7844:Trip11 UTSW 12 101878144 missense probably damaging 1.00
R8076:Trip11 UTSW 12 101883482 missense probably damaging 1.00
R8288:Trip11 UTSW 12 101894384 missense possibly damaging 0.73
R8294:Trip11 UTSW 12 101844901 missense possibly damaging 0.93
R8318:Trip11 UTSW 12 101912804 missense unknown
X0020:Trip11 UTSW 12 101885913 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTCTTTCTAGAAGGCCACTTTGTG -3'
(R):5'- GATAAAACTAGTACTGTGTTCAGAGGG -3'

Sequencing Primer
(F):5'- GTGATAAAGTTCACACACATACAGTG -3'
(R):5'- TGTTCAGAGGGTTCTTTCATTAAATC -3'
Posted On2020-01-23