Incidental Mutation 'R8055:Clybl'
ID619339
Institutional Source Beutler Lab
Gene Symbol Clybl
Ensembl Gene ENSMUSG00000025545
Gene Namecitrate lyase beta like
SynonymsClb, 2310014M14Rik, 0610033J05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8055 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location122181704-122402234 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 122377861 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 204 (D204E)
Ref Sequence ENSEMBL: ENSMUSP00000026625 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026625]
Predicted Effect probably damaging
Transcript: ENSMUST00000026625
AA Change: D204E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026625
Gene: ENSMUSG00000025545
AA Change: D204E

DomainStartEndE-ValueType
Pfam:HpcH_HpaI 44 272 1.4e-51 PFAM
Pfam:C-C_Bond_Lyase 218 334 2.9e-10 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahcyl1 A T 3: 107,668,731 D353E probably benign Het
Alk G T 17: 71,899,257 P1033T probably benign Het
Asb15 G T 6: 24,556,566 C20F probably benign Het
BC049715 A G 6: 136,839,915 N51S possibly damaging Het
Ccser1 G A 6: 61,313,773 V480M possibly damaging Het
Cep295 T C 9: 15,333,609 N1184D probably benign Het
Cers6 C T 2: 68,947,281 R111W probably damaging Het
Cxcl13 T C 5: 95,959,904 V73A probably benign Het
Dchs2 A G 3: 83,129,725 N593S probably benign Het
Esco2 A T 14: 65,831,719 N47K probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fmo4 T C 1: 162,808,446 T46A probably benign Het
Gm15217 T C 14: 46,379,454 probably benign Het
Gm9774 C A 3: 92,428,832 G188W unknown Het
Gnb5 G T 9: 75,343,544 A317S probably benign Het
Klf14 A G 6: 30,957,787 V304A probably benign Het
Klrc2 A T 6: 129,656,461 C209* probably null Het
Kmt2a A T 9: 44,821,081 N2646K unknown Het
Krt14 C G 11: 100,204,758 V274L possibly damaging Het
Myo16 A T 8: 10,562,186 D1277V unknown Het
Myo9a A T 9: 59,907,460 E2226D probably damaging Het
Osbpl8 T C 10: 111,284,394 V631A possibly damaging Het
Piezo2 G A 18: 63,042,811 S1833L probably damaging Het
Pkp4 T C 2: 59,308,015 V203A probably benign Het
Primpol T C 8: 46,579,162 D459G probably benign Het
Prkdc G T 16: 15,816,885 R3631S probably benign Het
Rbbp8nl T C 2: 180,278,208 T558A probably benign Het
Rcc2 G A 4: 140,702,275 C40Y probably benign Het
Rdx G A 9: 52,086,424 R566Q probably damaging Het
Rhbdf2 A C 11: 116,607,365 S3A probably benign Het
Rpap1 A T 2: 119,764,803 I1319N probably benign Het
Sbno2 T A 10: 80,069,431 I206F possibly damaging Het
Scn1a A G 2: 66,319,501 V944A probably damaging Het
Scube1 C T 15: 83,659,025 probably null Het
Slc22a20 G A 19: 5,971,411 A521V probably benign Het
Slc6a4 C A 11: 77,010,598 T53K probably benign Het
Snapc2 G A 8: 4,254,322 R75Q probably damaging Het
Sptan1 A T 2: 29,994,339 K662I probably benign Het
Sycp3 T C 10: 88,462,576 S55P probably damaging Het
Tet2 A T 3: 133,467,992 V1503D possibly damaging Het
Tfrc T A 16: 32,618,656 N277K probably benign Het
Tlx3 A T 11: 33,201,283 V291E probably damaging Het
Tnk1 A T 11: 69,856,501 H101Q probably benign Het
Tns3 A T 11: 8,545,343 D70E probably damaging Het
Trip11 C A 12: 101,837,665 G1938C probably damaging Het
Tubg1 T C 11: 101,124,002 L190P probably damaging Het
Vmn2r79 A T 7: 87,037,333 S641C possibly damaging Het
Wnt8b A G 19: 44,493,513 probably benign Het
Other mutations in Clybl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Clybl APN 14 122379198 splice site probably benign
IGL01380:Clybl APN 14 122379349 missense probably benign 0.04
IGL01589:Clybl APN 14 122371422 missense probably damaging 1.00
IGL02043:Clybl APN 14 122379252 missense probably damaging 1.00
IGL03111:Clybl APN 14 122401983 missense probably damaging 1.00
IGL03328:Clybl APN 14 122401994 missense probably damaging 0.99
R2104:Clybl UTSW 14 122311306 missense probably damaging 1.00
R4869:Clybl UTSW 14 122384206 missense probably damaging 1.00
R5067:Clybl UTSW 14 122379289 missense possibly damaging 0.77
R5138:Clybl UTSW 14 122371304 missense possibly damaging 0.46
R5255:Clybl UTSW 14 122384279 missense probably benign 0.02
R5620:Clybl UTSW 14 122311343 missense probably damaging 0.97
R6982:Clybl UTSW 14 122401947 missense probably damaging 1.00
R7162:Clybl UTSW 14 122371320 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGAAGATCTCAGTTTGTCTTAGCC -3'
(R):5'- TGTCATGAAAAGGCACCATCG -3'

Sequencing Primer
(F):5'- ATCTCAGTTTGTCTTAGCCTAAGTG -3'
(R):5'- TCGGGGCTAGCAAATACAC -3'
Posted On2020-01-23