Incidental Mutation 'R8056:Adamtsl1'
ID619360
Institutional Source Beutler Lab
Gene Symbol Adamtsl1
Ensembl Gene ENSMUSG00000066113
Gene NameADAMTS-like 1
Synonyms5930437A14Rik, 6720426B09Rik, punctin-1
Accession Numbers

Genbank: NM_172542; MGI: 1924989; Ensembl: ENSMUST00000141889

Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock #R8056 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location85514172-86428385 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 86342032 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 835 (P835S)
Ref Sequence ENSEMBL: ENSMUSP00000102796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107178] [ENSMUST00000141889]
Predicted Effect possibly damaging
Transcript: ENSMUST00000107178
AA Change: P835S

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000102796
Gene: ENSMUSG00000066113
AA Change: P835S

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
TSP1 36 82 8.95e-7 SMART
TSP1 301 360 4.35e-2 SMART
TSP1 362 421 2.05e-2 SMART
TSP1 422 476 3.99e-4 SMART
TSP1 508 567 6.39e-3 SMART
TSP1 593 650 7.86e-3 SMART
TSP1 652 712 3.78e-5 SMART
TSP1 715 772 2.66e-2 SMART
TSP1 774 833 1.62e-4 SMART
IGc2 873 937 4.19e-6 SMART
low complexity region 1123 1142 N/A INTRINSIC
IGc2 1175 1240 1.31e-7 SMART
IGc2 1282 1351 7.81e-15 SMART
IGc2 1400 1467 2.39e-10 SMART
TSP1 1481 1537 2.12e-1 SMART
TSP1 1540 1599 1.74e-4 SMART
TSP1 1600 1658 8.2e0 SMART
TSP1 1660 1717 1.96e-1 SMART
Pfam:PLAC 1721 1751 1.4e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000141889
AA Change: P827S

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000119278
Gene: ENSMUSG00000066113
AA Change: P827S

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
TSP1 36 82 8.95e-7 SMART
TSP1 301 360 4.35e-2 SMART
TSP1 379 438 2.05e-2 SMART
TSP1 439 493 3.99e-4 SMART
TSP1 525 584 6.39e-3 SMART
TSP1 610 667 7.86e-3 SMART
TSP1 707 764 2.66e-2 SMART
TSP1 766 825 1.62e-4 SMART
IGc2 865 929 4.19e-6 SMART
low complexity region 1115 1134 N/A INTRINSIC
IGc2 1167 1232 1.31e-7 SMART
IGc2 1274 1343 7.81e-15 SMART
IGc2 1392 1459 2.39e-10 SMART
TSP1 1473 1529 2.12e-1 SMART
TSP1 1532 1591 1.74e-4 SMART
TSP1 1592 1650 8.2e0 SMART
TSP1 1652 1709 1.96e-1 SMART
Pfam:PLAC 1712 1744 5.6e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a secreted protein and member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motif) family. This protein lacks the metalloproteinase and disintegrin-like domains, which are typical of the ADAMTS family, but contains other ADAMTS domains, including the thrombospondin type 1 motif. This protein may have important functions in the extracellular matrix. Alternative splicing results in multiple transcript variants encoding distinct proteins. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(3) : Gene trapped(3)

Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik A G 9: 103,266,224 C438R probably damaging Het
9930111J21Rik2 T C 11: 49,020,082 E508G probably benign Het
Acsl3 C T 1: 78,681,894 L88F probably damaging Het
Agrn A G 4: 156,170,411 V1616A probably benign Het
Brca2 T C 5: 150,569,306 V3262A possibly damaging Het
Bsn T C 9: 108,105,307 D977G Het
Cic G T 7: 25,290,941 A1956S possibly damaging Het
Clip4 C A 17: 71,803,592 T189K probably damaging Het
Col12a1 T C 9: 79,599,938 E279G Het
Col24a1 A C 3: 145,314,164 I99L possibly damaging Het
Cpne3 A G 4: 19,532,426 V329A possibly damaging Het
Cyp17a1 T C 19: 46,670,591 I204V possibly damaging Het
Cyp2c66 A G 19: 39,142,041 I107V probably benign Het
Dennd4c A G 4: 86,844,976 R1840G probably null Het
Dhx36 A T 3: 62,488,591 L465Q possibly damaging Het
Fam133b A T 5: 3,565,744 R215S unknown Het
Fbxo18 G A 2: 11,743,630 T985I probably benign Het
Fras1 A G 5: 96,744,774 D2911G probably damaging Het
Gm11639 A G 11: 104,909,070 T2931A probably damaging Het
Gm13889 A T 2: 93,956,675 D151E probably damaging Het
Gosr2 C A 11: 103,697,704 probably benign Het
Igkv8-26 T A 6: 70,193,722 L99H probably damaging Het
Kif16b A G 2: 142,712,842 F679L probably damaging Het
Kif3b G C 2: 153,330,059 R716S possibly damaging Het
Lilra6 A T 7: 3,912,552 C395S probably damaging Het
Lrp5 A G 19: 3,597,337 F1302L probably damaging Het
Map2 T G 1: 66,415,620 V1223G probably damaging Het
Mical1 T A 10: 41,481,172 N324K probably damaging Het
Morc3 T A 16: 93,845,176 H94Q probably benign Het
Mpped1 T C 15: 83,836,462 V199A possibly damaging Het
Msx1 G A 5: 37,824,200 T45I probably benign Het
Myh7 G A 14: 54,973,319 Q1714* probably null Het
Narf T C 11: 121,245,344 V182A possibly damaging Het
Ncapd2 G A 6: 125,171,043 T1107M probably damaging Het
Nek3 A G 8: 22,129,343 probably null Het
Neurog1 G T 13: 56,251,410 P175T probably damaging Het
Nlrp9c T C 7: 26,385,687 T156A probably damaging Het
Olfr1377 T A 11: 50,985,541 V280E probably damaging Het
Olfr434 A T 6: 43,217,044 I44F probably damaging Het
Olfr788 G A 10: 129,473,192 A167T probably benign Het
Orm3 A G 4: 63,359,357 E194G probably benign Het
Pik3r2 G T 8: 70,772,367 P151T probably benign Het
Pkp2 T C 16: 16,213,400 C10R probably benign Het
Plxdc1 T A 11: 97,978,517 R82W probably damaging Het
Polr2c G A 8: 94,860,267 A54T probably benign Het
Rab31 T C 17: 65,717,508 I59V probably benign Het
Rasgrf2 T C 13: 92,030,813 M251V probably damaging Het
Rcc2 G A 4: 140,702,275 C40Y probably benign Het
Rhag T C 17: 40,828,788 I137T probably damaging Het
Rnf216 T C 5: 142,992,861 M841V probably benign Het
Scaf11 C A 15: 96,414,817 E1448* probably null Het
Sept11 T C 5: 93,167,576 L388P unknown Het
Skint10 A G 4: 112,715,813 I262T probably benign Het
Slc13a4 C T 6: 35,268,952 G586E probably damaging Het
Slc8a1 C T 17: 81,647,923 G562E probably damaging Het
Slc8b1 T A 5: 120,520,617 L126Q probably damaging Het
Smg1 A G 7: 118,160,366 Y2086H unknown Het
Taf1c A T 8: 119,603,463 D47E probably benign Het
Tbx5 A C 5: 119,853,613 M250L probably benign Het
Tekt3 T C 11: 63,083,959 probably null Het
Tex43 A G 18: 56,594,691 N79S Het
Topors T C 4: 40,262,221 I354M probably benign Het
Ttn C A 2: 76,948,230 G1309V unknown Het
Ubac1 A G 2: 26,007,897 I237T probably benign Het
Vmn1r197 T A 13: 22,328,218 V103D probably damaging Het
Zfp184 T C 13: 21,958,838 F238S probably damaging Het
Zfp445 A G 9: 122,851,967 F970L possibly damaging Het
Zfp90 A T 8: 106,424,480 E275V probably damaging Het
Zscan12 C G 13: 21,369,322 Q439E probably benign Het
Other mutations in Adamtsl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Adamtsl1 APN 4 86385640 missense probably benign 0.01
IGL00741:Adamtsl1 APN 4 86276948 missense probably damaging 1.00
IGL00770:Adamtsl1 APN 4 86388539 missense possibly damaging 0.65
IGL00774:Adamtsl1 APN 4 86388539 missense possibly damaging 0.65
IGL00826:Adamtsl1 APN 4 86156804 missense probably damaging 1.00
IGL00938:Adamtsl1 APN 4 86342278 missense possibly damaging 0.93
IGL01012:Adamtsl1 APN 4 86342189 missense possibly damaging 0.93
IGL01728:Adamtsl1 APN 4 86110837 missense probably damaging 1.00
IGL01801:Adamtsl1 APN 4 86199322 missense probably benign 0.23
IGL01922:Adamtsl1 APN 4 86249902 missense probably damaging 1.00
IGL02006:Adamtsl1 APN 4 86199345 missense probably damaging 1.00
IGL02192:Adamtsl1 APN 4 86228016 missense probably damaging 1.00
IGL02351:Adamtsl1 APN 4 86156873 critical splice donor site probably null
IGL02358:Adamtsl1 APN 4 86156873 critical splice donor site probably null
IGL02373:Adamtsl1 APN 4 86249805 missense probably damaging 1.00
IGL02660:Adamtsl1 APN 4 86232610 missense probably damaging 1.00
IGL02964:Adamtsl1 APN 4 86424357 missense probably damaging 1.00
IGL03233:Adamtsl1 APN 4 86342120 missense probably damaging 1.00
IGL03297:Adamtsl1 APN 4 86423426 missense probably damaging 0.98
IGL03326:Adamtsl1 APN 4 86252748 splice site probably benign
PIT4378001:Adamtsl1 UTSW 4 86199364 missense possibly damaging 0.93
PIT4418001:Adamtsl1 UTSW 4 86243724 missense probably damaging 1.00
R0131:Adamtsl1 UTSW 4 86342723 missense possibly damaging 0.94
R0131:Adamtsl1 UTSW 4 86342723 missense possibly damaging 0.94
R0132:Adamtsl1 UTSW 4 86342723 missense possibly damaging 0.94
R0453:Adamtsl1 UTSW 4 86232615 missense probably damaging 1.00
R0480:Adamtsl1 UTSW 4 86252818 missense probably benign 0.08
R0496:Adamtsl1 UTSW 4 86341198 missense probably damaging 1.00
R0538:Adamtsl1 UTSW 4 86343121 missense probably benign 0.27
R0547:Adamtsl1 UTSW 4 86356355 missense probably benign 0.37
R0567:Adamtsl1 UTSW 4 86228016 missense probably damaging 1.00
R0568:Adamtsl1 UTSW 4 86418552 missense probably damaging 1.00
R0639:Adamtsl1 UTSW 4 86277143 missense probably damaging 1.00
R0931:Adamtsl1 UTSW 4 86249847 missense probably benign 0.05
R1186:Adamtsl1 UTSW 4 86388509 missense probably benign 0.00
R1387:Adamtsl1 UTSW 4 86374993 splice site probably benign
R1459:Adamtsl1 UTSW 4 86425865 missense probably damaging 1.00
R1518:Adamtsl1 UTSW 4 86342603 missense probably damaging 0.99
R1532:Adamtsl1 UTSW 4 86248065 missense probably benign 0.02
R1603:Adamtsl1 UTSW 4 86415530 missense probably benign
R1931:Adamtsl1 UTSW 4 86342411 missense possibly damaging 0.62
R2086:Adamtsl1 UTSW 4 86228012 missense probably damaging 1.00
R2221:Adamtsl1 UTSW 4 86388525 missense probably benign 0.19
R2223:Adamtsl1 UTSW 4 86388525 missense probably benign 0.19
R2396:Adamtsl1 UTSW 4 86343119 nonsense probably null
R2397:Adamtsl1 UTSW 4 86199357 missense probably damaging 1.00
R2426:Adamtsl1 UTSW 4 86156788 missense probably benign 0.01
R3121:Adamtsl1 UTSW 4 86337009 missense probably damaging 1.00
R3715:Adamtsl1 UTSW 4 86216976 missense probably benign 0.01
R3848:Adamtsl1 UTSW 4 86418546 missense probably damaging 1.00
R3849:Adamtsl1 UTSW 4 86418546 missense probably damaging 1.00
R3850:Adamtsl1 UTSW 4 86418546 missense probably damaging 1.00
R4194:Adamtsl1 UTSW 4 86054008 intron probably benign
R4354:Adamtsl1 UTSW 4 86156684 missense probably damaging 1.00
R4795:Adamtsl1 UTSW 4 86243769 critical splice donor site probably null
R4830:Adamtsl1 UTSW 4 86356382 missense probably damaging 0.97
R4874:Adamtsl1 UTSW 4 86342492 missense possibly damaging 0.94
R4939:Adamtsl1 UTSW 4 86243725 missense possibly damaging 0.95
R4942:Adamtsl1 UTSW 4 86341214 nonsense probably null
R4947:Adamtsl1 UTSW 4 85764800 missense possibly damaging 0.93
R4960:Adamtsl1 UTSW 4 86424173 nonsense probably null
R4971:Adamtsl1 UTSW 4 86336931 missense probably damaging 1.00
R5141:Adamtsl1 UTSW 4 86156850 missense possibly damaging 0.77
R5213:Adamtsl1 UTSW 4 86385628 missense possibly damaging 0.89
R5237:Adamtsl1 UTSW 4 86385669 critical splice donor site probably null
R5250:Adamtsl1 UTSW 4 86216945 nonsense probably null
R5411:Adamtsl1 UTSW 4 86388413 critical splice acceptor site probably null
R5554:Adamtsl1 UTSW 4 86276945 missense possibly damaging 0.69
R5631:Adamtsl1 UTSW 4 86276923 nonsense probably null
R5739:Adamtsl1 UTSW 4 86232664 missense probably damaging 1.00
R5905:Adamtsl1 UTSW 4 86342324 missense probably damaging 1.00
R6028:Adamtsl1 UTSW 4 86342324 missense probably damaging 1.00
R6044:Adamtsl1 UTSW 4 86212691 missense probably damaging 1.00
R6261:Adamtsl1 UTSW 4 86336878 missense probably benign 0.09
R6300:Adamtsl1 UTSW 4 86248017 missense probably damaging 1.00
R6332:Adamtsl1 UTSW 4 86217011 missense probably damaging 0.96
R6560:Adamtsl1 UTSW 4 86336893 missense probably damaging 1.00
R6693:Adamtsl1 UTSW 4 86342886 missense probably benign 0.27
R6736:Adamtsl1 UTSW 4 86342247 missense probably damaging 1.00
R6964:Adamtsl1 UTSW 4 86156854 missense probably damaging 1.00
R7064:Adamtsl1 UTSW 4 86342041 missense possibly damaging 0.80
R7434:Adamtsl1 UTSW 4 86425878 missense probably damaging 0.99
R7477:Adamtsl1 UTSW 4 86415651 missense probably damaging 1.00
R7545:Adamtsl1 UTSW 4 85764855 missense probably damaging 1.00
R7556:Adamtsl1 UTSW 4 86277121 missense probably benign 0.19
R7580:Adamtsl1 UTSW 4 86054064 missense possibly damaging 0.53
R7593:Adamtsl1 UTSW 4 86341213 missense probably damaging 1.00
R7710:Adamtsl1 UTSW 4 86232573 missense
R7908:Adamtsl1 UTSW 4 86356439 missense probably benign 0.02
R7989:Adamtsl1 UTSW 4 86356439 missense probably benign 0.02
R8143:Adamtsl1 UTSW 4 86342255 missense possibly damaging 0.71
Z1176:Adamtsl1 UTSW 4 86342177 missense probably damaging 0.99
Z1176:Adamtsl1 UTSW 4 86342693 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- ACACCTCACTAGTGCTCTGG -3'
(R):5'- GTCCTTTTCCCACGTGATGAGG -3'

Sequencing Primer
(F):5'- TAGCCTGATGATCCACAGCTGATAG -3'
(R):5'- ATGAGGGGCTTGCGGAATC -3'
Posted On2020-01-23