Incidental Mutation 'R8056:Sept11'
ID619367
Institutional Source Beutler Lab
Gene Symbol Sept11
Ensembl Gene ENSMUSG00000058013
Gene Nameseptin 11
Synonyms6230410I01Rik, D5Ertd606e
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.399) question?
Stock #R8056 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location93093437-93176447 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 93167576 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 388 (L388P)
Ref Sequence ENSEMBL: ENSMUSP00000074293 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074733] [ENSMUST00000201421] [ENSMUST00000201700] [ENSMUST00000202217] [ENSMUST00000202308]
Predicted Effect unknown
Transcript: ENSMUST00000074733
AA Change: L388P
SMART Domains Protein: ENSMUSP00000074293
Gene: ENSMUSG00000058013
AA Change: L388P

DomainStartEndE-ValueType
Pfam:Septin 38 311 5.3e-101 PFAM
Pfam:MMR_HSR1 43 185 3.8e-8 PFAM
low complexity region 350 366 N/A INTRINSIC
low complexity region 376 391 N/A INTRINSIC
low complexity region 396 419 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000201421
AA Change: L388P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000143928
Gene: ENSMUSG00000058013
AA Change: L388P

DomainStartEndE-ValueType
Pfam:Septin 38 311 5.3e-101 PFAM
Pfam:MMR_HSR1 43 185 3.8e-8 PFAM
low complexity region 350 366 N/A INTRINSIC
low complexity region 376 391 N/A INTRINSIC
low complexity region 396 419 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000201700
AA Change: L388P
SMART Domains Protein: ENSMUSP00000143901
Gene: ENSMUSG00000058013
AA Change: L388P

DomainStartEndE-ValueType
Pfam:Septin 38 311 7.9e-99 PFAM
Pfam:MMR_HSR1 43 185 7e-7 PFAM
coiled coil region 333 409 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000202217
AA Change: L388P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000144235
Gene: ENSMUSG00000058013
AA Change: L388P

DomainStartEndE-ValueType
Pfam:Septin 38 311 7.7e-101 PFAM
Pfam:MMR_HSR1 43 185 4.1e-8 PFAM
low complexity region 350 366 N/A INTRINSIC
low complexity region 376 391 N/A INTRINSIC
low complexity region 396 419 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000202308
AA Change: L388P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000144136
Gene: ENSMUSG00000058013
AA Change: L388P

DomainStartEndE-ValueType
Pfam:Septin 38 311 5.1e-101 PFAM
Pfam:MMR_HSR1 43 185 3.7e-8 PFAM
low complexity region 350 366 N/A INTRINSIC
low complexity region 376 391 N/A INTRINSIC
low complexity region 396 419 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SEPT11 belongs to the conserved septin family of filament-forming cytoskeletal GTPases that are involved in a variety of cellular functions including cytokinesis and vesicle trafficking (Hanai et al., 2004 [PubMed 15196925]; Nagata et al., 2004 [PubMed 15485874]).[supplied by OMIM, Jul 2009]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik A G 9: 103,266,224 C438R probably damaging Het
9930111J21Rik2 T C 11: 49,020,082 E508G probably benign Het
Acsl3 C T 1: 78,681,894 L88F probably damaging Het
Adamtsl1 C T 4: 86,342,032 P835S possibly damaging Het
Agrn A G 4: 156,170,411 V1616A probably benign Het
Brca2 T C 5: 150,569,306 V3262A possibly damaging Het
Bsn T C 9: 108,105,307 D977G Het
Cic G T 7: 25,290,941 A1956S possibly damaging Het
Clip4 C A 17: 71,803,592 T189K probably damaging Het
Col12a1 T C 9: 79,599,938 E279G Het
Col24a1 A C 3: 145,314,164 I99L possibly damaging Het
Cpne3 A G 4: 19,532,426 V329A possibly damaging Het
Cyp17a1 T C 19: 46,670,591 I204V possibly damaging Het
Cyp2c66 A G 19: 39,142,041 I107V probably benign Het
Dennd4c A G 4: 86,844,976 R1840G probably null Het
Dhx36 A T 3: 62,488,591 L465Q possibly damaging Het
Fam133b A T 5: 3,565,744 R215S unknown Het
Fbxo18 G A 2: 11,743,630 T985I probably benign Het
Fras1 A G 5: 96,744,774 D2911G probably damaging Het
Gm11639 A G 11: 104,909,070 T2931A probably damaging Het
Gm13889 A T 2: 93,956,675 D151E probably damaging Het
Gosr2 C A 11: 103,697,704 probably benign Het
Igkv8-26 T A 6: 70,193,722 L99H probably damaging Het
Kif16b A G 2: 142,712,842 F679L probably damaging Het
Kif3b G C 2: 153,330,059 R716S possibly damaging Het
Lilra6 A T 7: 3,912,552 C395S probably damaging Het
Lrp5 A G 19: 3,597,337 F1302L probably damaging Het
Map2 T G 1: 66,415,620 V1223G probably damaging Het
Mical1 T A 10: 41,481,172 N324K probably damaging Het
Morc3 T A 16: 93,845,176 H94Q probably benign Het
Mpped1 T C 15: 83,836,462 V199A possibly damaging Het
Msx1 G A 5: 37,824,200 T45I probably benign Het
Myh7 G A 14: 54,973,319 Q1714* probably null Het
Narf T C 11: 121,245,344 V182A possibly damaging Het
Ncapd2 G A 6: 125,171,043 T1107M probably damaging Het
Nek3 A G 8: 22,129,343 probably null Het
Neurog1 G T 13: 56,251,410 P175T probably damaging Het
Nlrp9c T C 7: 26,385,687 T156A probably damaging Het
Olfr1377 T A 11: 50,985,541 V280E probably damaging Het
Olfr434 A T 6: 43,217,044 I44F probably damaging Het
Olfr788 G A 10: 129,473,192 A167T probably benign Het
Orm3 A G 4: 63,359,357 E194G probably benign Het
Pik3r2 G T 8: 70,772,367 P151T probably benign Het
Pkp2 T C 16: 16,213,400 C10R probably benign Het
Plxdc1 T A 11: 97,978,517 R82W probably damaging Het
Polr2c G A 8: 94,860,267 A54T probably benign Het
Rab31 T C 17: 65,717,508 I59V probably benign Het
Rasgrf2 T C 13: 92,030,813 M251V probably damaging Het
Rcc2 G A 4: 140,702,275 C40Y probably benign Het
Rhag T C 17: 40,828,788 I137T probably damaging Het
Rnf216 T C 5: 142,992,861 M841V probably benign Het
Scaf11 C A 15: 96,414,817 E1448* probably null Het
Skint10 A G 4: 112,715,813 I262T probably benign Het
Slc13a4 C T 6: 35,268,952 G586E probably damaging Het
Slc8a1 C T 17: 81,647,923 G562E probably damaging Het
Slc8b1 T A 5: 120,520,617 L126Q probably damaging Het
Smg1 A G 7: 118,160,366 Y2086H unknown Het
Taf1c A T 8: 119,603,463 D47E probably benign Het
Tbx5 A C 5: 119,853,613 M250L probably benign Het
Tekt3 T C 11: 63,083,959 probably null Het
Tex43 A G 18: 56,594,691 N79S Het
Topors T C 4: 40,262,221 I354M probably benign Het
Ttn C A 2: 76,948,230 G1309V unknown Het
Ubac1 A G 2: 26,007,897 I237T probably benign Het
Vmn1r197 T A 13: 22,328,218 V103D probably damaging Het
Zfp184 T C 13: 21,958,838 F238S probably damaging Het
Zfp445 A G 9: 122,851,967 F970L possibly damaging Het
Zfp90 A T 8: 106,424,480 E275V probably damaging Het
Zscan12 C G 13: 21,369,322 Q439E probably benign Het
Other mutations in Sept11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Sept11 APN 5 93157018 splice site probably null
IGL00984:Sept11 APN 5 93162184 missense possibly damaging 0.90
IGL01452:Sept11 APN 5 93161204 missense possibly damaging 0.82
IGL01677:Sept11 APN 5 93148533 missense probably damaging 0.98
IGL01732:Sept11 APN 5 93161226 missense probably damaging 1.00
IGL02476:Sept11 APN 5 93148584 critical splice donor site probably null
I0000:Sept11 UTSW 5 93165259 missense probably benign 0.05
R0544:Sept11 UTSW 5 93165368 missense possibly damaging 0.80
R0611:Sept11 UTSW 5 93167534 missense probably damaging 0.99
R1438:Sept11 UTSW 5 93148428 missense probably damaging 1.00
R1702:Sept11 UTSW 5 93156924 missense probably damaging 1.00
R1727:Sept11 UTSW 5 93156924 missense probably damaging 1.00
R3838:Sept11 UTSW 5 93148399 missense probably damaging 1.00
R3847:Sept11 UTSW 5 93162167 missense probably damaging 1.00
R4609:Sept11 UTSW 5 93162254 missense possibly damaging 0.89
R4717:Sept11 UTSW 5 93156956 missense possibly damaging 0.89
R4852:Sept11 UTSW 5 93162253 missense possibly damaging 0.52
R4986:Sept11 UTSW 5 93161241 missense probably damaging 1.00
R5806:Sept11 UTSW 5 93167578 missense probably benign 0.18
R5826:Sept11 UTSW 5 93139450 missense possibly damaging 0.79
R5896:Sept11 UTSW 5 93156965 missense probably damaging 1.00
R6641:Sept11 UTSW 5 93139552 missense probably damaging 1.00
R7144:Sept11 UTSW 5 93156866 missense probably benign 0.00
R7479:Sept11 UTSW 5 93156945 missense probably damaging 0.99
R7757:Sept11 UTSW 5 93171464 intron probably null
R8103:Sept11 UTSW 5 93161148 critical splice acceptor site probably null
Z1177:Sept11 UTSW 5 93156963 missense probably damaging 0.96
Z1177:Sept11 UTSW 5 93162283 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CCACCCAGATATGTCAGACTTG -3'
(R):5'- GGCCAGTTTCCAGTCTGTAAG -3'

Sequencing Primer
(F):5'- GCTGACTTACCATTCAGAGGCTTAG -3'
(R):5'- TTTCCAGTCTGTAAGTAGGAAAAGG -3'
Posted On2020-01-23