Incidental Mutation 'R8056:Rnf216'
ID619371
Institutional Source Beutler Lab
Gene Symbol Rnf216
Ensembl Gene ENSMUSG00000045078
Gene Namering finger protein 216
Synonyms2810055G22Rik, Ubce7ip1, F830018F18Rik, UIP83
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8056 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location142990893-143112994 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 142992861 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 841 (M841V)
Ref Sequence ENSEMBL: ENSMUSP00000143705 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053498] [ENSMUST00000197296] [ENSMUST00000200430] [ENSMUST00000200607]
Predicted Effect probably benign
Transcript: ENSMUST00000053498
AA Change: M784V

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000052563
Gene: ENSMUSG00000045078
AA Change: M784V

DomainStartEndE-ValueType
Blast:RING 560 620 4e-6 BLAST
IBR 629 693 6.82e-5 SMART
IBR 702 769 1.79e-1 SMART
low complexity region 786 803 N/A INTRINSIC
low complexity region 842 866 N/A INTRINSIC
low complexity region 869 881 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197296
Predicted Effect probably benign
Transcript: ENSMUST00000200430
Predicted Effect probably benign
Transcript: ENSMUST00000200607
AA Change: M841V

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000143705
Gene: ENSMUSG00000045078
AA Change: M841V

DomainStartEndE-ValueType
Blast:RING 560 620 4e-6 BLAST
IBR 629 693 6.82e-5 SMART
IBR 702 769 1.79e-1 SMART
low complexity region 786 803 N/A INTRINSIC
low complexity region 842 866 N/A INTRINSIC
low complexity region 869 881 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein which specifically colocalizes and interacts with the serine/threonine protein kinase, receptor-interacting protein (RIP). Zinc finger domains of the encoded protein are required for its interaction with RIP and for inhibition of TNF- and IL1-induced NF-kappa B activation pathways. The encoded protein may also function as an E3 ubiquitin-protein ligase which accepts ubiquitin from E2 ubiquitin-conjugating enzymes and transfers it to substrates. Several alternatively spliced transcript variants have been described for this locus but the full-length natures of only some are known. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik A G 9: 103,266,224 C438R probably damaging Het
2900011O08Rik T A 16: 14,038,316 probably benign Het
9930111J21Rik2 T C 11: 49,020,082 E508G probably benign Het
Acsl3 C T 1: 78,681,894 L88F probably damaging Het
Adamtsl1 C T 4: 86,342,032 P835S possibly damaging Het
Agrn A G 4: 156,170,411 V1616A probably benign Het
Brca2 T C 5: 150,569,306 V3262A possibly damaging Het
Bsn T C 9: 108,105,307 D977G Het
Cic G T 7: 25,290,941 A1956S possibly damaging Het
Clip4 C A 17: 71,803,592 T189K probably damaging Het
Col12a1 T C 9: 79,599,938 E279G Het
Col24a1 A C 3: 145,314,164 I99L possibly damaging Het
Cpne3 A G 4: 19,532,426 V329A possibly damaging Het
Cyp17a1 T C 19: 46,670,591 I204V possibly damaging Het
Cyp2c66 A G 19: 39,142,041 I107V probably benign Het
Dennd4c A G 4: 86,844,976 R1840G probably null Het
Dhx36 A T 3: 62,488,591 L465Q possibly damaging Het
Edc4 A G 8: 105,890,484 probably benign Het
Fam133b A T 5: 3,565,744 R215S unknown Het
Fbxo18 G A 2: 11,743,630 T985I probably benign Het
Fras1 A G 5: 96,744,774 D2911G probably damaging Het
Gm11639 A G 11: 104,909,070 T2931A probably damaging Het
Gm13889 A T 2: 93,956,675 D151E probably damaging Het
Gosr2 C A 11: 103,697,704 probably benign Het
Igkv8-26 T A 6: 70,193,722 L99H probably damaging Het
Kif16b A G 2: 142,712,842 F679L probably damaging Het
Kif1a G C 1: 93,054,701 probably benign Het
Kif3b G C 2: 153,330,059 R716S possibly damaging Het
Lilra6 A T 7: 3,912,552 C395S probably damaging Het
Lrp5 A G 19: 3,597,337 F1302L probably damaging Het
Map2 T G 1: 66,415,620 V1223G probably damaging Het
Mical1 T A 10: 41,481,172 N324K probably damaging Het
Morc3 T A 16: 93,845,176 H94Q probably benign Het
Mpped1 T C 15: 83,836,462 V199A possibly damaging Het
Msx1 G A 5: 37,824,200 T45I probably benign Het
Myh7 G A 14: 54,973,319 Q1714* probably null Het
Narf T C 11: 121,245,344 V182A possibly damaging Het
Ncapd2 G A 6: 125,171,043 T1107M probably damaging Het
Nek3 A G 8: 22,129,343 probably null Het
Neurog1 G T 13: 56,251,410 P175T probably damaging Het
Nlrp9c T C 7: 26,385,687 T156A probably damaging Het
Olfr1377 T A 11: 50,985,541 V280E probably damaging Het
Olfr434 A T 6: 43,217,044 I44F probably damaging Het
Olfr788 G A 10: 129,473,192 A167T probably benign Het
Orm3 A G 4: 63,359,357 E194G probably benign Het
Pga5 A C 19: 10,676,797 probably benign Het
Pik3r2 G T 8: 70,772,367 P151T probably benign Het
Pkp2 T C 16: 16,213,400 C10R probably benign Het
Plxdc1 T A 11: 97,978,517 R82W probably damaging Het
Polr2c G A 8: 94,860,267 A54T probably benign Het
Rab31 T C 17: 65,717,508 I59V probably benign Het
Rasgrf2 T C 13: 92,030,813 M251V probably damaging Het
Rcc2 G A 4: 140,702,275 C40Y probably benign Het
Rfc1 A C 5: 65,294,093 probably benign Het
Rhag T C 17: 40,828,788 I137T probably damaging Het
Scaf11 C A 15: 96,414,817 E1448* probably null Het
Sept11 T C 5: 93,167,576 L388P unknown Het
Serpina1b A T 12: 103,817,878 probably benign Het
Skint10 A G 4: 112,715,813 I262T probably benign Het
Slc13a4 C T 6: 35,268,952 G586E probably damaging Het
Slc8a1 C T 17: 81,647,923 G562E probably damaging Het
Slc8b1 T A 5: 120,520,617 L126Q probably damaging Het
Smg1 A G 7: 118,160,366 Y2086H unknown Het
Taf1c A T 8: 119,603,463 D47E probably benign Het
Tbx5 A C 5: 119,853,613 M250L probably benign Het
Tekt3 T C 11: 63,083,959 probably null Het
Tex43 A G 18: 56,594,691 N79S Het
Topors T C 4: 40,262,221 I354M probably benign Het
Ttn C A 2: 76,948,230 G1309V unknown Het
Ttyh1 C T 7: 4,124,623 probably benign Het
Ubac1 A G 2: 26,007,897 I237T probably benign Het
Vmn1r197 T A 13: 22,328,218 V103D probably damaging Het
Zfp184 T C 13: 21,958,838 F238S probably damaging Het
Zfp445 A G 9: 122,851,967 F970L possibly damaging Het
Zfp90 A T 8: 106,424,480 E275V probably damaging Het
Zscan12 C G 13: 21,369,322 Q439E probably benign Het
Other mutations in Rnf216
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02417:Rnf216 APN 5 143068910 missense possibly damaging 0.67
IGL02502:Rnf216 APN 5 143068867 missense probably damaging 1.00
IGL02536:Rnf216 APN 5 143080240 missense probably benign 0.04
IGL03196:Rnf216 APN 5 143081011 missense probably damaging 1.00
PIT4445001:Rnf216 UTSW 5 143086003 missense probably damaging 1.00
R0270:Rnf216 UTSW 5 143080241 missense possibly damaging 0.63
R0422:Rnf216 UTSW 5 143015654 nonsense probably null
R0422:Rnf216 UTSW 5 143090370 missense probably benign 0.15
R0782:Rnf216 UTSW 5 143068892 missense possibly damaging 0.64
R1109:Rnf216 UTSW 5 143068369 missense probably damaging 1.00
R1917:Rnf216 UTSW 5 142992806 missense probably benign 0.03
R2233:Rnf216 UTSW 5 143090926 missense probably benign
R2234:Rnf216 UTSW 5 143090926 missense probably benign
R2235:Rnf216 UTSW 5 143090926 missense probably benign
R2340:Rnf216 UTSW 5 143080334 missense probably damaging 0.99
R3015:Rnf216 UTSW 5 143075725 critical splice donor site probably null
R3726:Rnf216 UTSW 5 143027946 missense probably damaging 0.96
R4231:Rnf216 UTSW 5 143093090 missense probably damaging 1.00
R4885:Rnf216 UTSW 5 143090580 nonsense probably null
R4942:Rnf216 UTSW 5 143093059 missense probably damaging 1.00
R4973:Rnf216 UTSW 5 143090316 missense probably benign
R5291:Rnf216 UTSW 5 143090212 missense probably benign
R5307:Rnf216 UTSW 5 143093002 missense probably damaging 1.00
R5328:Rnf216 UTSW 5 143092999 missense possibly damaging 0.84
R5416:Rnf216 UTSW 5 143015771 nonsense probably null
R5888:Rnf216 UTSW 5 143068314 splice site probably null
R6048:Rnf216 UTSW 5 143068904 missense probably damaging 1.00
R6451:Rnf216 UTSW 5 142992834 missense possibly damaging 0.80
R6595:Rnf216 UTSW 5 143090657 missense probably benign 0.00
R7422:Rnf216 UTSW 5 143090836 missense probably benign 0.01
R7470:Rnf216 UTSW 5 142992725 missense possibly damaging 0.88
R7504:Rnf216 UTSW 5 143075759 missense probably benign 0.27
R7507:Rnf216 UTSW 5 143089802 missense probably damaging 1.00
R7695:Rnf216 UTSW 5 143085904 missense possibly damaging 0.80
R7757:Rnf216 UTSW 5 143080236 missense probably damaging 1.00
R7768:Rnf216 UTSW 5 143098444 start codon destroyed probably null 1.00
R8081:Rnf216 UTSW 5 143027964 missense probably damaging 0.98
Z1176:Rnf216 UTSW 5 143098443 start codon destroyed probably null 0.99
Z1177:Rnf216 UTSW 5 142992807 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTGGGTGTCAGAAGCGATGC -3'
(R):5'- CCACAGGAGCACATAGTGAG -3'

Sequencing Primer
(F):5'- CAGAAGCGATGCCGTGGTTG -3'
(R):5'- ATGCAGAGCCCTAGTCAGG -3'
Posted On2020-01-23