Incidental Mutation 'R8056:Pik3r2'
ID619382
Institutional Source Beutler Lab
Gene Symbol Pik3r2
Ensembl Gene ENSMUSG00000031834
Gene Namephosphoinositide-3-kinase regulatory subunit 2
Synonymsp85beta
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8056 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location70768176-70776713 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 70772367 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 151 (P151T)
Ref Sequence ENSEMBL: ENSMUSP00000034296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034296] [ENSMUST00000143785]
PDB Structure CRYSTAL STRUCTURE OF P110BETA IN COMPLEX WITH ICSH2 OF P85BETA AND THE DRUG GDC-0941 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000034296
AA Change: P151T

PolyPhen 2 Score 0.142 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000034296
Gene: ENSMUSG00000031834
AA Change: P151T

DomainStartEndE-ValueType
SH3 7 79 4e-7 SMART
RhoGAP 122 286 2.36e-18 SMART
low complexity region 291 311 N/A INTRINSIC
SH2 322 405 4.51e-26 SMART
Pfam:PI3K_P85_iSH2 422 590 1.7e-64 PFAM
SH2 614 696 9.96e-28 SMART
low complexity region 713 718 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143785
SMART Domains Protein: ENSMUSP00000122065
Gene: ENSMUSG00000031834

DomainStartEndE-ValueType
Blast:RhoGAP 1 30 1e-8 BLAST
Pfam:SH2 33 70 4.5e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154685
SMART Domains Protein: ENSMUSP00000121463
Gene: ENSMUSG00000031834

DomainStartEndE-ValueType
PDB:2XS6|A 43 84 3e-11 PDB
SCOP:d1pbwa_ 47 79 6e-9 SMART
Blast:RhoGAP 58 84 4e-9 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphatidylinositol 3-kinase (PI3K) is a lipid kinase that phosphorylates phosphatidylinositol and similar compounds, creating second messengers important in growth signaling pathways. PI3K functions as a heterodimer of a regulatory and a catalytic subunit. The protein encoded by this gene is a regulatory component of PI3K. Two transcript variants, one protein coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for disruptions in this gene have lower blood glucose levels both when fed and after fasting. Insulin sensitivity is improved as well. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik A G 9: 103,266,224 C438R probably damaging Het
2900011O08Rik T A 16: 14,038,316 probably benign Het
9930111J21Rik2 T C 11: 49,020,082 E508G probably benign Het
Acsl3 C T 1: 78,681,894 L88F probably damaging Het
Adamtsl1 C T 4: 86,342,032 P835S possibly damaging Het
Agrn A G 4: 156,170,411 V1616A probably benign Het
Brca2 T C 5: 150,569,306 V3262A possibly damaging Het
Bsn T C 9: 108,105,307 D977G Het
Cic G T 7: 25,290,941 A1956S possibly damaging Het
Clip4 C A 17: 71,803,592 T189K probably damaging Het
Col12a1 T C 9: 79,599,938 E279G Het
Col24a1 A C 3: 145,314,164 I99L possibly damaging Het
Cpne3 A G 4: 19,532,426 V329A possibly damaging Het
Cyp17a1 T C 19: 46,670,591 I204V possibly damaging Het
Cyp2c66 A G 19: 39,142,041 I107V probably benign Het
Dennd4c A G 4: 86,844,976 R1840G probably null Het
Dhx36 A T 3: 62,488,591 L465Q possibly damaging Het
Edc4 A G 8: 105,890,484 probably benign Het
Fam133b A T 5: 3,565,744 R215S unknown Het
Fbxo18 G A 2: 11,743,630 T985I probably benign Het
Fras1 A G 5: 96,744,774 D2911G probably damaging Het
Gm11639 A G 11: 104,909,070 T2931A probably damaging Het
Gm13889 A T 2: 93,956,675 D151E probably damaging Het
Gosr2 C A 11: 103,697,704 probably benign Het
Igkv8-26 T A 6: 70,193,722 L99H probably damaging Het
Kif16b A G 2: 142,712,842 F679L probably damaging Het
Kif1a G C 1: 93,054,701 probably benign Het
Kif3b G C 2: 153,330,059 R716S possibly damaging Het
Lilra6 A T 7: 3,912,552 C395S probably damaging Het
Lrp5 A G 19: 3,597,337 F1302L probably damaging Het
Map2 T G 1: 66,415,620 V1223G probably damaging Het
Mical1 T A 10: 41,481,172 N324K probably damaging Het
Morc3 T A 16: 93,845,176 H94Q probably benign Het
Mpped1 T C 15: 83,836,462 V199A possibly damaging Het
Msx1 G A 5: 37,824,200 T45I probably benign Het
Myh7 G A 14: 54,973,319 Q1714* probably null Het
Narf T C 11: 121,245,344 V182A possibly damaging Het
Ncapd2 G A 6: 125,171,043 T1107M probably damaging Het
Nek3 A G 8: 22,129,343 probably null Het
Neurog1 G T 13: 56,251,410 P175T probably damaging Het
Nlrp9c T C 7: 26,385,687 T156A probably damaging Het
Olfr1377 T A 11: 50,985,541 V280E probably damaging Het
Olfr434 A T 6: 43,217,044 I44F probably damaging Het
Olfr788 G A 10: 129,473,192 A167T probably benign Het
Orm3 A G 4: 63,359,357 E194G probably benign Het
Pga5 A C 19: 10,676,797 probably benign Het
Pkp2 T C 16: 16,213,400 C10R probably benign Het
Plxdc1 T A 11: 97,978,517 R82W probably damaging Het
Polr2c G A 8: 94,860,267 A54T probably benign Het
Rab31 T C 17: 65,717,508 I59V probably benign Het
Rasgrf2 T C 13: 92,030,813 M251V probably damaging Het
Rcc2 G A 4: 140,702,275 C40Y probably benign Het
Rfc1 A C 5: 65,294,093 probably benign Het
Rhag T C 17: 40,828,788 I137T probably damaging Het
Rnf216 T C 5: 142,992,861 M841V probably benign Het
Scaf11 C A 15: 96,414,817 E1448* probably null Het
Sept11 T C 5: 93,167,576 L388P unknown Het
Serpina1b A T 12: 103,817,878 probably benign Het
Skint10 A G 4: 112,715,813 I262T probably benign Het
Slc13a4 C T 6: 35,268,952 G586E probably damaging Het
Slc8a1 C T 17: 81,647,923 G562E probably damaging Het
Slc8b1 T A 5: 120,520,617 L126Q probably damaging Het
Smg1 A G 7: 118,160,366 Y2086H unknown Het
Taf1c A T 8: 119,603,463 D47E probably benign Het
Tbx5 A C 5: 119,853,613 M250L probably benign Het
Tekt3 T C 11: 63,083,959 probably null Het
Tex43 A G 18: 56,594,691 N79S Het
Topors T C 4: 40,262,221 I354M probably benign Het
Ttn C A 2: 76,948,230 G1309V unknown Het
Ttyh1 C T 7: 4,124,623 probably benign Het
Ubac1 A G 2: 26,007,897 I237T probably benign Het
Vmn1r197 T A 13: 22,328,218 V103D probably damaging Het
Zfp184 T C 13: 21,958,838 F238S probably damaging Het
Zfp445 A G 9: 122,851,967 F970L possibly damaging Het
Zfp90 A T 8: 106,424,480 E275V probably damaging Het
Zscan12 C G 13: 21,369,322 Q439E probably benign Het
Other mutations in Pik3r2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00487:Pik3r2 APN 8 70770429 missense probably damaging 1.00
IGL01637:Pik3r2 APN 8 70772348 unclassified probably benign
IGL02514:Pik3r2 APN 8 70770592 missense probably benign 0.00
IGL03395:Pik3r2 APN 8 70772355 missense probably benign
kingfisher UTSW 8 70770901 missense probably damaging 1.00
R0022:Pik3r2 UTSW 8 70770901 missense probably damaging 1.00
R0022:Pik3r2 UTSW 8 70770901 missense probably damaging 1.00
R0448:Pik3r2 UTSW 8 70772044 unclassified probably benign
R1636:Pik3r2 UTSW 8 70771898 missense probably benign
R1662:Pik3r2 UTSW 8 70770606 missense probably damaging 1.00
R2114:Pik3r2 UTSW 8 70769385 missense probably benign 0.31
R2879:Pik3r2 UTSW 8 70772385 missense probably benign
R3830:Pik3r2 UTSW 8 70770421 missense probably benign 0.19
R3852:Pik3r2 UTSW 8 70770421 missense probably benign 0.19
R3859:Pik3r2 UTSW 8 70769986 missense probably damaging 1.00
R3967:Pik3r2 UTSW 8 70770421 missense probably benign 0.19
R3968:Pik3r2 UTSW 8 70770421 missense probably benign 0.19
R3969:Pik3r2 UTSW 8 70770421 missense probably benign 0.19
R3970:Pik3r2 UTSW 8 70770421 missense probably benign 0.19
R4606:Pik3r2 UTSW 8 70772136 nonsense probably null
R4666:Pik3r2 UTSW 8 70768859 missense possibly damaging 0.93
R5481:Pik3r2 UTSW 8 70769764 missense probably benign 0.31
R6445:Pik3r2 UTSW 8 70772026 missense probably benign 0.01
R6578:Pik3r2 UTSW 8 70772639 missense probably benign 0.00
R6667:Pik3r2 UTSW 8 70769173 missense probably damaging 1.00
R6794:Pik3r2 UTSW 8 70770717 missense probably benign 0.43
R6863:Pik3r2 UTSW 8 70770414 missense probably damaging 1.00
R7378:Pik3r2 UTSW 8 70769381 missense probably benign 0.03
R7750:Pik3r2 UTSW 8 70770901 missense probably damaging 1.00
R7821:Pik3r2 UTSW 8 70769764 missense probably damaging 1.00
R8237:Pik3r2 UTSW 8 70772150 missense probably benign 0.00
R8414:Pik3r2 UTSW 8 70770435 missense probably damaging 1.00
R8534:Pik3r2 UTSW 8 70774668 missense probably benign
R8781:Pik3r2 UTSW 8 70769402 missense possibly damaging 0.88
R8794:Pik3r2 UTSW 8 70771363 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCAGGAAGCCCTTAACAGCATC -3'
(R):5'- TTGAGCAAGCAGGTGAGGTC -3'

Sequencing Primer
(F):5'- CTTAACAGCATCATACAAGGCGGTG -3'
(R):5'- CAGCCTGGTCTTTTCATGGACAG -3'
Posted On2020-01-23