Incidental Mutation 'R8056:Zscan12'
ID619399
Institutional Source Beutler Lab
Gene Symbol Zscan12
Ensembl Gene ENSMUSG00000036721
Gene Namezinc finger and SCAN domain containing 12
SynonymsZfp96
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8056 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location21362820-21372289 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 21369322 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Glutamic Acid at position 439 (Q439E)
Ref Sequence ENSEMBL: ENSMUSP00000058904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053293] [ENSMUST00000099720] [ENSMUST00000225545]
Predicted Effect probably benign
Transcript: ENSMUST00000053293
AA Change: Q439E

PolyPhen 2 Score 0.288 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000058904
Gene: ENSMUSG00000036721
AA Change: Q439E

DomainStartEndE-ValueType
SCAN 42 154 2.52e-74 SMART
ZnF_C2H2 269 291 5.5e-3 SMART
ZnF_C2H2 297 319 1.72e-4 SMART
ZnF_C2H2 325 347 1.22e-4 SMART
ZnF_C2H2 353 375 5.5e-3 SMART
ZnF_C2H2 381 403 1.95e-3 SMART
ZnF_C2H2 409 431 1.45e-2 SMART
ZnF_C2H2 455 477 2.43e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000099720
AA Change: Q439E

PolyPhen 2 Score 0.288 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000097308
Gene: ENSMUSG00000036721
AA Change: Q439E

DomainStartEndE-ValueType
SCAN 42 154 2.52e-74 SMART
ZnF_C2H2 269 291 5.5e-3 SMART
ZnF_C2H2 297 319 1.72e-4 SMART
ZnF_C2H2 325 347 1.22e-4 SMART
ZnF_C2H2 353 375 5.5e-3 SMART
ZnF_C2H2 381 403 1.95e-3 SMART
ZnF_C2H2 409 431 1.45e-2 SMART
ZnF_C2H2 455 477 2.43e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000225545
AA Change: Q439E

PolyPhen 2 Score 0.288 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik A G 9: 103,266,224 C438R probably damaging Het
9930111J21Rik2 T C 11: 49,020,082 E508G probably benign Het
Acsl3 C T 1: 78,681,894 L88F probably damaging Het
Adamtsl1 C T 4: 86,342,032 P835S possibly damaging Het
Agrn A G 4: 156,170,411 V1616A probably benign Het
Brca2 T C 5: 150,569,306 V3262A possibly damaging Het
Bsn T C 9: 108,105,307 D977G Het
Cic G T 7: 25,290,941 A1956S possibly damaging Het
Clip4 C A 17: 71,803,592 T189K probably damaging Het
Col12a1 T C 9: 79,599,938 E279G Het
Col24a1 A C 3: 145,314,164 I99L possibly damaging Het
Cpne3 A G 4: 19,532,426 V329A possibly damaging Het
Cyp17a1 T C 19: 46,670,591 I204V possibly damaging Het
Cyp2c66 A G 19: 39,142,041 I107V probably benign Het
Dennd4c A G 4: 86,844,976 R1840G probably null Het
Dhx36 A T 3: 62,488,591 L465Q possibly damaging Het
Fam133b A T 5: 3,565,744 R215S unknown Het
Fbxo18 G A 2: 11,743,630 T985I probably benign Het
Fras1 A G 5: 96,744,774 D2911G probably damaging Het
Gm11639 A G 11: 104,909,070 T2931A probably damaging Het
Gm13889 A T 2: 93,956,675 D151E probably damaging Het
Gosr2 C A 11: 103,697,704 probably benign Het
Igkv8-26 T A 6: 70,193,722 L99H probably damaging Het
Kif16b A G 2: 142,712,842 F679L probably damaging Het
Kif3b G C 2: 153,330,059 R716S possibly damaging Het
Lilra6 A T 7: 3,912,552 C395S probably damaging Het
Lrp5 A G 19: 3,597,337 F1302L probably damaging Het
Map2 T G 1: 66,415,620 V1223G probably damaging Het
Mical1 T A 10: 41,481,172 N324K probably damaging Het
Morc3 T A 16: 93,845,176 H94Q probably benign Het
Mpped1 T C 15: 83,836,462 V199A possibly damaging Het
Msx1 G A 5: 37,824,200 T45I probably benign Het
Myh7 G A 14: 54,973,319 Q1714* probably null Het
Narf T C 11: 121,245,344 V182A possibly damaging Het
Ncapd2 G A 6: 125,171,043 T1107M probably damaging Het
Nek3 A G 8: 22,129,343 probably null Het
Neurog1 G T 13: 56,251,410 P175T probably damaging Het
Nlrp9c T C 7: 26,385,687 T156A probably damaging Het
Olfr1377 T A 11: 50,985,541 V280E probably damaging Het
Olfr434 A T 6: 43,217,044 I44F probably damaging Het
Olfr788 G A 10: 129,473,192 A167T probably benign Het
Orm3 A G 4: 63,359,357 E194G probably benign Het
Pik3r2 G T 8: 70,772,367 P151T probably benign Het
Pkp2 T C 16: 16,213,400 C10R probably benign Het
Plxdc1 T A 11: 97,978,517 R82W probably damaging Het
Polr2c G A 8: 94,860,267 A54T probably benign Het
Rab31 T C 17: 65,717,508 I59V probably benign Het
Rasgrf2 T C 13: 92,030,813 M251V probably damaging Het
Rcc2 G A 4: 140,702,275 C40Y probably benign Het
Rhag T C 17: 40,828,788 I137T probably damaging Het
Rnf216 T C 5: 142,992,861 M841V probably benign Het
Scaf11 C A 15: 96,414,817 E1448* probably null Het
Sept11 T C 5: 93,167,576 L388P unknown Het
Skint10 A G 4: 112,715,813 I262T probably benign Het
Slc13a4 C T 6: 35,268,952 G586E probably damaging Het
Slc8a1 C T 17: 81,647,923 G562E probably damaging Het
Slc8b1 T A 5: 120,520,617 L126Q probably damaging Het
Smg1 A G 7: 118,160,366 Y2086H unknown Het
Taf1c A T 8: 119,603,463 D47E probably benign Het
Tbx5 A C 5: 119,853,613 M250L probably benign Het
Tekt3 T C 11: 63,083,959 probably null Het
Tex43 A G 18: 56,594,691 N79S Het
Topors T C 4: 40,262,221 I354M probably benign Het
Ttn C A 2: 76,948,230 G1309V unknown Het
Ubac1 A G 2: 26,007,897 I237T probably benign Het
Vmn1r197 T A 13: 22,328,218 V103D probably damaging Het
Zfp184 T C 13: 21,958,838 F238S probably damaging Het
Zfp445 A G 9: 122,851,967 F970L possibly damaging Het
Zfp90 A T 8: 106,424,480 E275V probably damaging Het
Other mutations in Zscan12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02864:Zscan12 APN 13 21368560 missense probably benign 0.02
PIT4480001:Zscan12 UTSW 13 21368574 missense possibly damaging 0.72
R0122:Zscan12 UTSW 13 21368969 missense probably damaging 1.00
R1605:Zscan12 UTSW 13 21366643 missense probably benign 0.00
R1639:Zscan12 UTSW 13 21368986 missense probably damaging 0.99
R2182:Zscan12 UTSW 13 21368791 missense probably benign 0.33
R2931:Zscan12 UTSW 13 21364017 missense possibly damaging 0.92
R3930:Zscan12 UTSW 13 21368630 missense probably benign 0.18
R4368:Zscan12 UTSW 13 21369383 missense probably benign 0.00
R4461:Zscan12 UTSW 13 21366619 missense possibly damaging 0.83
R4545:Zscan12 UTSW 13 21366705 missense possibly damaging 0.83
R5353:Zscan12 UTSW 13 21364008 missense possibly damaging 0.51
R6580:Zscan12 UTSW 13 21369158 missense probably damaging 0.99
R6734:Zscan12 UTSW 13 21368796 nonsense probably null
R7462:Zscan12 UTSW 13 21369287 missense possibly damaging 0.94
R7505:Zscan12 UTSW 13 21368586 missense possibly damaging 0.72
R7822:Zscan12 UTSW 13 21369204 missense probably damaging 0.99
R8028:Zscan12 UTSW 13 21368852 missense probably benign 0.01
R8161:Zscan12 UTSW 13 21363727 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGTTTTACTCAGCACTCGCG -3'
(R):5'- AAGCTCTGACTCCTGTCTGAAGG -3'

Sequencing Primer
(F):5'- TATTCGACACAAGGTGGTCC -3'
(R):5'- GCCACATTCATCACACTTGTAGGG -3'
Posted On2020-01-23