Mutagenetix > Incidental Mutation

Incidental Mutation 'R8056:Rasgrf2'

619403

Institutional Source

Beutler Lab

Gene Symbol

Rasgrf2

Ensembl Gene

ENSMUSG00000021708

Gene Name

RAS protein-specific guanine nucleotide-releasing factor 2

Synonyms

Grf2, 6330417G04Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.184) question?

Stock #

R8056 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

91880400-92131656 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 92030813 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Valine at position 251 (M251V)

Ref Sequence

ENSEMBL: ENSMUSP00000096930 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099326] [ENSMUST00000146492] [ENSMUST00000216219]

AlphaFold

P70392

Predicted Effect

probably damaging
Transcript: ENSMUST00000099326
AA Change: M251V

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000096930
Gene: ENSMUSG00000021708
AA Change: M251V

Domain	Start	End	E-Value	Type
PH	23	135	1.29e-16	SMART
IQ	204	226	1.3e0	SMART
RhoGEF	247	428	2.2e-51	SMART
RasGEFN	633	775	9.35e-15	SMART
RasGEFN	786	923	6.04e-9	SMART
RasGEF	949	1186	2.97e-112	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000146492
AA Change: M251V

PolyPhen 2 Score 0.702 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000116203
Gene: ENSMUSG00000021708
AA Change: M251V

Domain	Start	End	E-Value	Type
PH	23	135	1.29e-16	SMART
IQ	204	226	1.3e0	SMART
Pfam:RhoGEF	247	387	1.2e-24	PFAM

Predicted Effect

SMART Domains

Protein: ENSMUSP00000115562
Gene: ENSMUSG00000021708
AA Change: M31V

Domain	Start	End	E-Value	Type
Pfam:RhoGEF	28	168	4.3e-26	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000216219
AA Change: M251V

PolyPhen 2 Score 0.556 (Sensitivity: 0.88; Specificity: 0.91)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (75/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RAS GTPases cycle between an inactive GDP-bound state and an active GTP-bound state. This gene encodes a calcium-regulated nucleotide exchange factor activating both RAS and RAS-related protein, RAC1, through the exchange of bound GDP for GTP, thereby, coordinating the signaling of distinct mitogen-activated protein kinase pathways. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit decreased Il2 and TNF-alpha production in stimulated T cells. Mice homozygous for mutations in both Rasgrf1 and Rasgrf2 exhibit no additional abnormalities than those observed in the Rasgrf1 mutant mice. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1300017J02Rik	A	G	9: 103,266,224	C438R	probably damaging	Het
2900011O08Rik	T	A	16: 14,038,316		probably benign	Het
9930111J21Rik2	T	C	11: 49,020,082	E508G	probably benign	Het
Acsl3	C	T	1: 78,681,894	L88F	probably damaging	Het
Adamtsl1	C	T	4: 86,342,032	P835S	possibly damaging	Het
Agrn	A	G	4: 156,170,411	V1616A	probably benign	Het
Brca2	T	C	5: 150,569,306	V3262A	possibly damaging	Het
Bsn	T	C	9: 108,105,307	D977G		Het
Cic	G	T	7: 25,290,941	A1956S	possibly damaging	Het
Clip4	C	A	17: 71,803,592	T189K	probably damaging	Het
Col12a1	T	C	9: 79,599,938	E279G		Het
Col24a1	A	C	3: 145,314,164	I99L	possibly damaging	Het
Cpne3	A	G	4: 19,532,426	V329A	possibly damaging	Het
Cyp17a1	T	C	19: 46,670,591	I204V	possibly damaging	Het
Cyp2c66	A	G	19: 39,142,041	I107V	probably benign	Het
Dennd4c	A	G	4: 86,844,976	R1840G	probably null	Het
Dhx36	A	T	3: 62,488,591	L465Q	possibly damaging	Het
Edc4	A	G	8: 105,890,484		probably benign	Het
Fam133b	A	T	5: 3,565,744	R215S	unknown	Het
Fbxo18	G	A	2: 11,743,630	T985I	probably benign	Het
Fras1	A	G	5: 96,744,774	D2911G	probably damaging	Het
Gm11639	A	G	11: 104,909,070	T2931A	probably damaging	Het
Gm13889	A	T	2: 93,956,675	D151E	probably damaging	Het
Gosr2	C	A	11: 103,697,704		probably benign	Het
Igkv8-26	T	A	6: 70,193,722	L99H	probably damaging	Het
Kif16b	A	G	2: 142,712,842	F679L	probably damaging	Het
Kif1a	G	C	1: 93,054,701		probably benign	Het
Kif3b	G	C	2: 153,330,059	R716S	possibly damaging	Het
Lilra6	A	T	7: 3,912,552	C395S	probably damaging	Het
Lrp5	A	G	19: 3,597,337	F1302L	probably damaging	Het
Map2	T	G	1: 66,415,620	V1223G	probably damaging	Het
Mical1	T	A	10: 41,481,172	N324K	probably damaging	Het
Morc3	T	A	16: 93,845,176	H94Q	probably benign	Het
Mpped1	T	C	15: 83,836,462	V199A	possibly damaging	Het
Msx1	G	A	5: 37,824,200	T45I	probably benign	Het
Myh7	G	A	14: 54,973,319	Q1714*	probably null	Het
Narf	T	C	11: 121,245,344	V182A	possibly damaging	Het
Ncapd2	G	A	6: 125,171,043	T1107M	probably damaging	Het
Nek3	A	G	8: 22,129,343		probably null	Het
Neurog1	G	T	13: 56,251,410	P175T	probably damaging	Het
Nlrp9c	T	C	7: 26,385,687	T156A	probably damaging	Het
Olfr1377	T	A	11: 50,985,541	V280E	probably damaging	Het
Olfr434	A	T	6: 43,217,044	I44F	probably damaging	Het
Olfr788	G	A	10: 129,473,192	A167T	probably benign	Het
Orm3	A	G	4: 63,359,357	E194G	probably benign	Het
Pga5	A	C	19: 10,676,797		probably benign	Het
Pik3r2	G	T	8: 70,772,367	P151T	probably benign	Het
Pkp2	T	C	16: 16,213,400	C10R	probably benign	Het
Plxdc1	T	A	11: 97,978,517	R82W	probably damaging	Het
Polr2c	G	A	8: 94,860,267	A54T	probably benign	Het
Rab31	T	C	17: 65,717,508	I59V	probably benign	Het
Rcc2	G	A	4: 140,702,275	C40Y	probably benign	Het
Rfc1	A	C	5: 65,294,093		probably benign	Het
Rhag	T	C	17: 40,828,788	I137T	probably damaging	Het
Rnf216	T	C	5: 142,992,861	M841V	probably benign	Het
Scaf11	C	A	15: 96,414,817	E1448*	probably null	Het
Sept11	T	C	5: 93,167,576	L388P	unknown	Het
Serpina1b	A	T	12: 103,817,878		probably benign	Het
Skint10	A	G	4: 112,715,813	I262T	probably benign	Het
Slc13a4	C	T	6: 35,268,952	G586E	probably damaging	Het
Slc8a1	C	T	17: 81,647,923	G562E	probably damaging	Het
Slc8b1	T	A	5: 120,520,617	L126Q	probably damaging	Het
Smg1	A	G	7: 118,160,366	Y2086H	unknown	Het
Taf1c	A	T	8: 119,603,463	D47E	probably benign	Het
Tbx5	A	C	5: 119,853,613	M250L	probably benign	Het
Tekt3	T	C	11: 63,083,959		probably null	Het
Tex43	A	G	18: 56,594,691	N79S		Het
Topors	T	C	4: 40,262,221	I354M	probably benign	Het
Ttn	C	A	2: 76,948,230	G1309V	unknown	Het
Ttyh1	C	T	7: 4,124,623		probably benign	Het
Ubac1	A	G	2: 26,007,897	I237T	probably benign	Het
Vmn1r197	T	A	13: 22,328,218	V103D	probably damaging	Het
Zfp184	T	C	13: 21,958,838	F238S	probably damaging	Het
Zfp445	A	G	9: 122,851,967	F970L	possibly damaging	Het
Zfp90	A	T	8: 106,424,480	E275V	probably damaging	Het
Zscan12	C	G	13: 21,369,322	Q439E	probably benign	Het

Other mutations in Rasgrf2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01308:Rasgrf2	APN	13	92022917	splice site	probably benign
IGL01358:Rasgrf2	APN	13	91982630	missense	probably benign	0.23
IGL01666:Rasgrf2	APN	13	92038210	missense	probably damaging	1.00
IGL01930:Rasgrf2	APN	13	91982738	missense	probably damaging	0.98
IGL02230:Rasgrf2	APN	13	91988026	missense	probably damaging	1.00
IGL02630:Rasgrf2	APN	13	92131392	missense	probably damaging	1.00
IGL02690:Rasgrf2	APN	13	92030765	missense	probably damaging	1.00
IGL02943:Rasgrf2	APN	13	91983633	missense	probably damaging	1.00
IGL03067:Rasgrf2	APN	13	92022905	missense	probably damaging	0.97
IGL03342:Rasgrf2	APN	13	91987979	missense	probably damaging	1.00
IGL03405:Rasgrf2	APN	13	91896051	missense	probably damaging	1.00
R0620:Rasgrf2	UTSW	13	91919817	splice site	probably benign
R0632:Rasgrf2	UTSW	13	91972274	missense	probably benign	0.00
R0894:Rasgrf2	UTSW	13	91982771	missense	probably damaging	1.00
R1354:Rasgrf2	UTSW	13	92028666	missense	probably damaging	1.00
R1400:Rasgrf2	UTSW	13	91887689	missense	probably damaging	1.00
R1437:Rasgrf2	UTSW	13	92030888	missense	probably damaging	1.00
R1443:Rasgrf2	UTSW	13	91983676	missense	probably damaging	1.00
R1522:Rasgrf2	UTSW	13	91896086	missense	probably benign	0.00
R1553:Rasgrf2	UTSW	13	91890664	missense	probably damaging	1.00
R1613:Rasgrf2	UTSW	13	91902621	missense	probably damaging	1.00
R1883:Rasgrf2	UTSW	13	91969030	missense	probably benign
R1934:Rasgrf2	UTSW	13	91983706	splice site	probably null
R1990:Rasgrf2	UTSW	13	92035965	missense	probably damaging	1.00
R2037:Rasgrf2	UTSW	13	91902629	missense	probably damaging	0.99
R2043:Rasgrf2	UTSW	13	92030843	missense	possibly damaging	0.91
R2135:Rasgrf2	UTSW	13	91972255	missense	probably benign
R2193:Rasgrf2	UTSW	13	92023713	splice site	probably null
R2406:Rasgrf2	UTSW	13	91972240	missense	probably benign
R3055:Rasgrf2	UTSW	13	92029075	missense	probably damaging	1.00
R3916:Rasgrf2	UTSW	13	92030788	missense	probably damaging	1.00
R3954:Rasgrf2	UTSW	13	91982855	missense	probably damaging	0.98
R3955:Rasgrf2	UTSW	13	91982855	missense	probably damaging	0.98
R3956:Rasgrf2	UTSW	13	91982855	missense	probably damaging	0.98
R4133:Rasgrf2	UTSW	13	91982654	missense	possibly damaging	0.59
R4177:Rasgrf2	UTSW	13	91890598	missense	probably damaging	1.00
R4178:Rasgrf2	UTSW	13	91890598	missense	probably damaging	1.00
R4357:Rasgrf2	UTSW	13	91890677	missense	probably damaging	1.00
R4358:Rasgrf2	UTSW	13	91890677	missense	probably damaging	1.00
R4359:Rasgrf2	UTSW	13	91890677	missense	probably damaging	1.00
R4439:Rasgrf2	UTSW	13	91983678	missense	possibly damaging	0.95
R4440:Rasgrf2	UTSW	13	91983678	missense	possibly damaging	0.95
R4441:Rasgrf2	UTSW	13	91983678	missense	possibly damaging	0.95
R4564:Rasgrf2	UTSW	13	91885654	nonsense	probably null
R4576:Rasgrf2	UTSW	13	91896410	missense	possibly damaging	0.58
R4590:Rasgrf2	UTSW	13	92038281	missense	probably damaging	1.00
R4718:Rasgrf2	UTSW	13	91990830	critical splice donor site	probably null
R4778:Rasgrf2	UTSW	13	91983661	missense	probably damaging	0.99
R4790:Rasgrf2	UTSW	13	91988016	missense	probably damaging	1.00
R4808:Rasgrf2	UTSW	13	92023682	missense	probably damaging	1.00
R5151:Rasgrf2	UTSW	13	91896036	missense	probably damaging	1.00
R5286:Rasgrf2	UTSW	13	92131433	missense	possibly damaging	0.94
R5902:Rasgrf2	UTSW	13	91919892	missense	probably damaging	1.00
R6180:Rasgrf2	UTSW	13	92029101	missense	probably damaging	1.00
R6264:Rasgrf2	UTSW	13	92030785	missense	probably damaging	1.00
R6369:Rasgrf2	UTSW	13	92131446	missense	probably benign
R6428:Rasgrf2	UTSW	13	91987981	missense	probably damaging	1.00
R6595:Rasgrf2	UTSW	13	92030853	missense	probably damaging	1.00
R6619:Rasgrf2	UTSW	13	92028519	missense	probably damaging	1.00
R6988:Rasgrf2	UTSW	13	91885635	missense	probably benign	0.02
R7026:Rasgrf2	UTSW	13	91983613	missense	probably damaging	1.00
R7038:Rasgrf2	UTSW	13	91982833	missense	possibly damaging	0.95
R7045:Rasgrf2	UTSW	13	92022592	intron	probably benign
R7056:Rasgrf2	UTSW	13	92030695	missense	probably damaging	0.99
R7058:Rasgrf2	UTSW	13	91886402	missense	probably damaging	0.99
R7256:Rasgrf2	UTSW	13	91884518	nonsense	probably null
R7392:Rasgrf2	UTSW	13	91893737	missense
R7469:Rasgrf2	UTSW	13	92029022	critical splice donor site	probably null
R7618:Rasgrf2	UTSW	13	91987966	missense
R7641:Rasgrf2	UTSW	13	92131406	missense	possibly damaging	0.65
R7674:Rasgrf2	UTSW	13	92131406	missense	possibly damaging	0.65
R7784:Rasgrf2	UTSW	13	91896082	missense
R7962:Rasgrf2	UTSW	13	92030792	missense	probably damaging	0.99
R8218:Rasgrf2	UTSW	13	91982677	missense
R8796:Rasgrf2	UTSW	13	91890566	missense
R8913:Rasgrf2	UTSW	13	92022526	missense	probably benign	0.05
R8971:Rasgrf2	UTSW	13	92021717	missense	possibly damaging	0.80
R9020:Rasgrf2	UTSW	13	92028638	missense	possibly damaging	0.93
R9487:Rasgrf2	UTSW	13	92131251	missense	probably benign
R9562:Rasgrf2	UTSW	13	91886350	critical splice donor site	probably null
R9712:Rasgrf2	UTSW	13	91987973	missense
R9766:Rasgrf2	UTSW	13	92023680	missense	probably damaging	1.00
R9800:Rasgrf2	UTSW	13	92131352	missense	probably damaging	0.99
X0013:Rasgrf2	UTSW	13	92030855	missense	probably damaging	1.00
X0026:Rasgrf2	UTSW	13	91902535	missense	probably damaging	0.99
Z1177:Rasgrf2	UTSW	13	91983513	missense
Z1177:Rasgrf2	UTSW	13	92022573	missense	unknown

Predicted Primers

PCR Primer
(F):5'- CTTTTCAGACTACAGGAGGGAC -3'
(R):5'- TTGCTTCCGGTTTCAGAAAGC -3'

Sequencing Primer
(F):5'- TTCAGACTACAGGAGGGACACTTTC -3'
(R):5'- TCAGAAAGCCGGTTTCATCG -3'

Posted On

2020-01-23