Mutagenetix > Incidental Mutation

Incidental Mutation 'R8057:Dnah7c'

619418

Institutional Source

Beutler Lab

Gene Symbol

Dnah7c

Ensembl Gene

ENSMUSG00000101337

Gene Name

dynein, axonemal, heavy chain 7C

Synonyms

Dnahc7c

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.312) question?

Stock #

R8057 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

46425592-46807476 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 46688952 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 2937 (C2937S)

Ref Sequence

ENSEMBL: ENSMUSP00000140430 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000189749]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000189749
AA Change: C2937S

PolyPhen 2 Score 0.517 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000140430
Gene: ENSMUSG00000101337
AA Change: C2937S

Domain	Start	End	E-Value	Type
low complexity region	2	15	N/A	INTRINSIC
low complexity region	37	48	N/A	INTRINSIC
coiled coil region	714	746	N/A	INTRINSIC
Pfam:DHC_N2	754	1167	2.2e-138	PFAM
AAA	1320	1459	4e-3	SMART
Blast:AAA	1601	1829	4e-87	BLAST
AAA	1968	2116	8.7e-4	SMART
Pfam:AAA_8	2303	2574	6.2e-73	PFAM
Pfam:MT	2586	2935	5.4e-52	PFAM
Pfam:AAA_9	2953	3183	7.4e-63	PFAM
Pfam:Dynein_heavy	3312	4021	1.3e-250	PFAM

Meta Mutation Damage Score

0.7952

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

100% (81/81)

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810013L24Rik	C	T	16: 8,830,368		probably benign	Het
4930523C07Rik	T	C	1: 160,075,256	L32P	probably damaging	Het
4930563M21Rik	T	C	9: 56,009,280	T38A	unknown	Het
Abcb6	T	C	1: 75,174,358	N563D	probably damaging	Het
Ak4	T	C	4: 101,460,653	F140S	probably damaging	Het
Arhgap27	T	A	11: 103,338,693	R296S	probably damaging	Het
Atxn7l1	A	C	12: 33,326,002	K98N	probably damaging	Het
Bex6	G	T	16: 32,186,406	D11Y	probably damaging	Het
Camta1	T	C	4: 151,144,032	D781G	probably damaging	Het
Capn7	A	G	14: 31,370,979	D800G	probably benign	Het
Carmil2	G	A	8: 105,692,376	V716I	probably benign	Het
Cdk5	C	A	5: 24,420,784	D144Y	probably damaging	Het
Cep85	T	C	4: 134,153,614		probably benign	Het
Chd5	T	A	4: 152,366,372	L651Q	probably damaging	Het
Clcn7	C	T	17: 25,149,259	Q261*	probably null	Het
Cntnap2	T	A	6: 46,347,145	F576Y	probably damaging	Het
Col11a1	G	A	3: 114,131,614	G815D	unknown	Het
Col4a4	T	A	1: 82,523,870	R387S	unknown	Het
Cse1l	T	A	2: 166,939,925	V663D	probably damaging	Het
Csf2rb2	G	T	15: 78,285,006	Q650K	probably damaging	Het
Ctnnd2	A	G	15: 30,847,351	D696G	possibly damaging	Het
D17Wsu92e	C	T	17: 27,767,889	A288T	unknown	Het
Epha10	A	T	4: 124,902,683	Q395L		Het
Fam167a	T	A	14: 63,452,320	V22E	probably benign	Het
Fan1	T	A	7: 64,372,486	N340Y	probably damaging	Het
Gabra4	A	G	5: 71,623,952	I372T	probably benign	Het
Gm3550	T	C	18: 34,737,529	F39L	probably damaging	Het
Gpt	A	G	15: 76,696,772		probably benign	Het
H2-K1	C	T	17: 33,996,859	G336D	possibly damaging	Het
Hoxd8	T	C	2: 74,704,726		probably null	Het
Kdm5d	T	G	Y: 927,355	D658E	possibly damaging	Het
Krt25	G	A	11: 99,317,343	T353M	probably benign	Het
Lonp2	T	C	8: 86,714,089	L778P	probably damaging	Het
Lrrc66	G	A	5: 73,607,532	Q723*	probably null	Het
Mak	T	A	13: 41,049,337	I212F	probably damaging	Het
Mastl	T	A	2: 23,133,554	R386W	possibly damaging	Het
Mis18bp1	A	G	12: 65,148,899	I697T	possibly damaging	Het
Nek5	G	A	8: 22,088,906	T415I	probably benign	Het
Neu3	T	A	7: 99,814,228	N96I	probably benign	Het
Nxph2	T	C	2: 23,400,095	V153A	possibly damaging	Het
Odf3l2	T	A	10: 79,640,001	H243L	probably damaging	Het
Olfr1454	G	A	19: 13,063,274		probably benign	Het
Olfr518	A	T	7: 108,881,364	F81I	probably damaging	Het
Olfr878	A	G	9: 37,919,164	D169G	probably benign	Het
Otogl	T	C	10: 107,808,615	T1257A	probably benign	Het
Pcdh10	G	A	3: 45,379,259	V3M	probably benign	Het
Pitpnm1	G	A	19: 4,112,145	R1017Q	probably null	Het
Plcb3	A	C	19: 6,955,095	H1065Q	probably benign	Het
Plcb3	A	T	19: 6,958,899	M752K	probably damaging	Het
Plch1	T	C	3: 63,698,136	E1449G	probably benign	Het
Plekha4	T	A	7: 45,549,271	C573S	probably benign	Het
Plin2	T	C	4: 86,657,401	I304V	possibly damaging	Het
Pnp2	G	A	14: 50,964,381	V275I	probably benign	Het
Polr1a	G	A	6: 71,931,660	A490T	possibly damaging	Het
Ppp1r12b	A	G	1: 134,955,616	F56S	probably damaging	Het
Ptk2	GA	G	15: 73,298,199		probably null	Het
Rb1cc1	C	A	1: 6,245,219	R473S	probably damaging	Het
Rcc2	G	A	4: 140,702,275	C40Y	probably benign	Het
Rdx	T	C	9: 52,065,646	V65A	probably damaging	Het
Rps6ka5	A	G	12: 100,573,796		probably null	Het
Samd5	C	T	10: 9,674,897	V23M	probably damaging	Het
Scn9a	T	G	2: 66,515,430	R1117S	probably benign	Het
Scrn1	T	A	6: 54,520,773	I278L	probably benign	Het
Sec31b	G	T	19: 44,519,365	P747T	probably damaging	Het
Sipa1l2	A	T	8: 125,468,530	V823E	probably damaging	Het
Slc2a13	T	C	15: 91,516,416	N201S	probably damaging	Het
Slc30a3	C	A	5: 31,090,051		probably benign	Het
Snx31	C	A	15: 36,523,460	V359F	probably damaging	Het
Sstr2	A	G	11: 113,624,273	E6G	probably benign	Het
Stc2	C	A	11: 31,367,806	E72*	probably null	Het
Tead1	C	T	7: 112,759,514	P11L	probably benign	Het
Tmem51	T	C	4: 142,031,748	T230A	probably damaging	Het
Tmem63c	A	T	12: 87,072,198	K301*	probably null	Het
Tns3	G	C	11: 8,492,773	A530G	probably benign	Het
Trat1	T	C	16: 48,742,237	D70G	probably damaging	Het
Trex1	T	A	9: 109,058,329	E198V	probably damaging	Het
Ttn	T	G	2: 76,739,728	R26940S	probably damaging	Het
Uba2	T	C	7: 34,168,410	K34R	possibly damaging	Het
Vps13d	A	C	4: 144,975,183	M4376R		Het
Zfp157	C	A	5: 138,456,074	T178K	probably damaging	Het
Zfp318	T	A	17: 46,399,766	V805D	possibly damaging	Het

Other mutations in Dnah7c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00559:Dnah7c	APN	1	46807289	missense	possibly damaging	0.72
IGL02958:Dnah7c	APN	1	46657111	missense	probably damaging	1.00
IGL03035:Dnah7c	APN	1	46524117	missense	probably benign	0.37
IGL03161:Dnah7c	APN	1	46467296	missense	probably benign	0.20
IGL03178:Dnah7c	APN	1	46467365	missense	probably benign
IGL03052:Dnah7c	UTSW	1	46632149	missense	probably damaging	1.00
R0751:Dnah7c	UTSW	1	46465905	missense	probably benign
R1029:Dnah7c	UTSW	1	46612721	missense	probably damaging	1.00
R3104:Dnah7c	UTSW	1	46798279	missense	probably damaging	0.97
R3977:Dnah7c	UTSW	1	46628911	missense	possibly damaging	0.75
R4003:Dnah7c	UTSW	1	46681817	missense	probably damaging	1.00
R4133:Dnah7c	UTSW	1	46665990	missense	probably benign	0.01
R4303:Dnah7c	UTSW	1	46748578	missense	probably damaging	1.00
R4329:Dnah7c	UTSW	1	46649281	missense	probably benign	0.33
R4434:Dnah7c	UTSW	1	46666282	missense	probably damaging	1.00
R4457:Dnah7c	UTSW	1	46740621	missense	probably damaging	1.00
R4470:Dnah7c	UTSW	1	46748635	missense	possibly damaging	0.56
R4507:Dnah7c	UTSW	1	46766611	missense	probably damaging	1.00
R4527:Dnah7c	UTSW	1	46532931	missense	probably benign	0.34
R4571:Dnah7c	UTSW	1	46533216	missense	probably damaging	0.99
R4589:Dnah7c	UTSW	1	46514583	nonsense	probably null
R4731:Dnah7c	UTSW	1	46770173	missense	probably damaging	1.00
R4732:Dnah7c	UTSW	1	46770173	missense	probably damaging	1.00
R4733:Dnah7c	UTSW	1	46770173	missense	probably damaging	1.00
R4747:Dnah7c	UTSW	1	46533168	missense	probably damaging	1.00
R4845:Dnah7c	UTSW	1	46793532	missense	probably damaging	1.00
R4873:Dnah7c	UTSW	1	46688925	missense	probably benign
R4875:Dnah7c	UTSW	1	46688925	missense	probably benign
R4916:Dnah7c	UTSW	1	46595008	missense	probably damaging	1.00
R5241:Dnah7c	UTSW	1	46530500	missense	probably benign
R5279:Dnah7c	UTSW	1	46519269	missense	probably benign	0.14
R5327:Dnah7c	UTSW	1	46665568	missense	probably benign	0.05
R5546:Dnah7c	UTSW	1	46666317	missense	probably damaging	1.00
R5605:Dnah7c	UTSW	1	46798235	missense	possibly damaging	0.84
R5637:Dnah7c	UTSW	1	46760361	splice site	probably null
R5639:Dnah7c	UTSW	1	46739668	missense	probably benign
R5663:Dnah7c	UTSW	1	46535148	missense	probably damaging	1.00
R5718:Dnah7c	UTSW	1	46748666	missense	possibly damaging	0.47
R5759:Dnah7c	UTSW	1	46615367	missense	probably damaging	1.00
R5771:Dnah7c	UTSW	1	46639665	missense	probably benign	0.00
R5784:Dnah7c	UTSW	1	46524068	missense	possibly damaging	0.80
R5800:Dnah7c	UTSW	1	46647015	missense	probably benign	0.01
R5933:Dnah7c	UTSW	1	46519215	missense	probably damaging	1.00
R5948:Dnah7c	UTSW	1	46672497	missense	probably benign	0.21
R6034:Dnah7c	UTSW	1	46457258	missense	probably benign	0.00
R6034:Dnah7c	UTSW	1	46457258	missense	probably benign	0.00
R6487:Dnah7c	UTSW	1	46769124	missense	probably damaging	1.00
R6536:Dnah7c	UTSW	1	46658290	missense	probably benign	0.00
R6614:Dnah7c	UTSW	1	46649340	missense	probably benign
R6614:Dnah7c	UTSW	1	46649351	missense	probably benign
R6615:Dnah7c	UTSW	1	46515439	missense	probably benign	0.01
R6615:Dnah7c	UTSW	1	46649340	missense	probably benign
R6615:Dnah7c	UTSW	1	46649351	missense	probably benign
R6649:Dnah7c	UTSW	1	46649340	missense	probably benign
R6649:Dnah7c	UTSW	1	46649351	missense	probably benign
R6650:Dnah7c	UTSW	1	46649340	missense	probably benign
R6650:Dnah7c	UTSW	1	46649351	missense	probably benign
R6651:Dnah7c	UTSW	1	46649340	missense	probably benign
R6651:Dnah7c	UTSW	1	46649351	missense	probably benign
R6653:Dnah7c	UTSW	1	46649340	missense	probably benign
R6653:Dnah7c	UTSW	1	46649351	missense	probably benign
R6714:Dnah7c	UTSW	1	46740806	missense	probably damaging	0.99
R6729:Dnah7c	UTSW	1	46672521	missense	possibly damaging	0.46
R6760:Dnah7c	UTSW	1	46649340	missense	probably benign
R6760:Dnah7c	UTSW	1	46649351	missense	probably benign
R6763:Dnah7c	UTSW	1	46628890	missense	possibly damaging	0.60
R6866:Dnah7c	UTSW	1	46657243	missense	probably damaging	1.00
R6880:Dnah7c	UTSW	1	46527671	missense	probably damaging	0.97
R6988:Dnah7c	UTSW	1	46666213	missense	possibly damaging	0.68
R6995:Dnah7c	UTSW	1	46455813	missense	probably benign	0.07
R7007:Dnah7c	UTSW	1	46532750	missense	probably benign	0.04
R7086:Dnah7c	UTSW	1	46750125	missense	probably benign	0.00
R7128:Dnah7c	UTSW	1	46527485	missense	probably benign
R7131:Dnah7c	UTSW	1	46681772	missense	probably benign	0.00
R7135:Dnah7c	UTSW	1	46533208	missense	probably damaging	1.00
R7171:Dnah7c	UTSW	1	46680738	missense	probably damaging	0.99
R7176:Dnah7c	UTSW	1	46430809	missense	probably benign	0.00
R7221:Dnah7c	UTSW	1	46455777	missense	possibly damaging	0.87
R7310:Dnah7c	UTSW	1	46596967	missense	possibly damaging	0.94
R7319:Dnah7c	UTSW	1	46780775	missense	probably benign	0.31
R7319:Dnah7c	UTSW	1	46784448	missense	possibly damaging	0.95
R7404:Dnah7c	UTSW	1	46666063	missense	possibly damaging	0.52
R7452:Dnah7c	UTSW	1	46647036	missense	possibly damaging	0.91
R7515:Dnah7c	UTSW	1	46457290	missense	probably benign
R7534:Dnah7c	UTSW	1	46770067	missense	probably damaging	0.98
R7542:Dnah7c	UTSW	1	46784498	missense	probably benign	0.00
R7605:Dnah7c	UTSW	1	46632310	missense	probably damaging	1.00
R7643:Dnah7c	UTSW	1	46602813	missense	probably benign
R7770:Dnah7c	UTSW	1	46626300	splice site	probably null
R7884:Dnah7c	UTSW	1	46791769	missense	probably benign	0.23
R7899:Dnah7c	UTSW	1	46514701	missense	probably benign	0.00
R8025:Dnah7c	UTSW	1	46457296	missense	probably benign	0.01
R8191:Dnah7c	UTSW	1	46607458	missense	possibly damaging	0.56
R8255:Dnah7c	UTSW	1	46659429	missense	probably damaging	1.00
R8428:Dnah7c	UTSW	1	46672376	missense	probably damaging	1.00
R8441:Dnah7c	UTSW	1	46533238	missense	probably damaging	1.00
R8485:Dnah7c	UTSW	1	46680792	missense	probably benign	0.05
R8559:Dnah7c	UTSW	1	46725139	missense	probably damaging	1.00
R8752:Dnah7c	UTSW	1	46672541	missense	probably benign	0.00
R8869:Dnah7c	UTSW	1	46632344	missense	probably damaging	0.97
R9058:Dnah7c	UTSW	1	46766656	missense	probably damaging	0.97
R9121:Dnah7c	UTSW	1	46665490	missense	probably damaging	0.97
R9121:Dnah7c	UTSW	1	46777736	missense	probably benign	0.00
R9246:Dnah7c	UTSW	1	46532774	missense	possibly damaging	0.51
R9319:Dnah7c	UTSW	1	46482008	missense	possibly damaging	0.94
R9388:Dnah7c	UTSW	1	46740726	missense	probably damaging	1.00
Z1176:Dnah7c	UTSW	1	46467302	missense	probably benign	0.00
Z1176:Dnah7c	UTSW	1	46615281	missense	probably damaging	1.00
Z1176:Dnah7c	UTSW	1	46639665	missense	probably benign
Z1176:Dnah7c	UTSW	1	46646992	critical splice acceptor site	probably null
Z1176:Dnah7c	UTSW	1	46760316	missense	possibly damaging	0.95
Z1177:Dnah7c	UTSW	1	46654103	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- CATGTGGGCTCTGTCTCATTGC -3'
(R):5'- GCTTACCATAGCTTCTGACAATTGAC -3'

Sequencing Primer
(F):5'- GGGCTCTGTCTCATTGCTTATTGC -3'
(R):5'- CAGCTAATTAGCAAACATTTC -3'

Posted On

2020-01-23