Incidental Mutation 'R0664:Hgfac'
ID61942
Institutional Source Beutler Lab
Gene Symbol Hgfac
Ensembl Gene ENSMUSG00000029102
Gene Namehepatocyte growth factor activator
SynonymsHGFA
MMRRC Submission 038849-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R0664 (G1)
Quality Score185
Status Validated
Chromosome5
Chromosomal Location35041509-35048461 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 35048178 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 601 (V601F)
Ref Sequence ENSEMBL: ENSMUSP00000030985 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030985] [ENSMUST00000202573]
Predicted Effect probably benign
Transcript: ENSMUST00000030985
AA Change: V601F

PolyPhen 2 Score 0.344 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000030985
Gene: ENSMUSG00000029102
AA Change: V601F

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
low complexity region 43 59 N/A INTRINSIC
low complexity region 85 93 N/A INTRINSIC
FN2 98 145 7.31e-27 SMART
EGF 160 195 2.11e-4 SMART
Pfam:fn1 199 234 7.7e-11 PFAM
EGF 241 276 1.69e-3 SMART
KR 281 366 5.2e-36 SMART
Tryp_SPc 405 639 2.07e-90 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201038
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201994
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202126
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202168
Predicted Effect probably benign
Transcript: ENSMUST00000202573
SMART Domains Protein: ENSMUSP00000144344
Gene: ENSMUSG00000029102

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202921
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.1%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: This gene encodes a serine protease enzyme that proteolytically activates hepatocyte growth factor (HGF) and plays a vital role in the regulation of HGF activity in the regeneration and repair of various tissues. The encoded protein is an inactive zymogen that is proteolytically activated to generate a heterodimeric enzyme consisting of a short chain and a long chain linked by a disulfide bridge. Mice lacking the encoded protein display an impairment in mucosal regeneration after injury. [provided by RefSeq, Jul 2015]
PHENOTYPE: Homozygous null mice display impaired intestinal regeneration and increased mortality after intestinal injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik GCC GC 13: 59,691,598 probably null Het
A530064D06Rik T C 17: 48,166,591 I53V probably benign Het
Agmo A T 12: 37,252,572 H136L probably damaging Het
B020004C17Rik G A 14: 57,016,768 R116H possibly damaging Het
Btbd11 G A 10: 85,388,370 A348T possibly damaging Het
Cacna1b A G 2: 24,654,446 S1243P probably damaging Het
Champ1 G A 8: 13,879,485 V548M probably damaging Het
Dnah7b A T 1: 46,324,842 M3541L probably damaging Het
Emc9 A G 14: 55,581,908 L138P possibly damaging Het
Epcam T A 17: 87,639,970 Y51N possibly damaging Het
Gpr55 A T 1: 85,941,017 S281T probably benign Het
Grid2ip T A 5: 143,363,977 probably null Het
Hlcs A G 16: 94,231,311 W545R probably damaging Het
Hsd17b2 T C 8: 117,758,701 V301A possibly damaging Het
Ipo8 A T 6: 148,800,213 L466I probably benign Het
Jcad A G 18: 4,676,063 D1275G probably damaging Het
Mdn1 G T 4: 32,768,011 E5315* probably null Het
Nfam1 T C 15: 83,014,938 T176A probably damaging Het
Nsd3 T C 8: 25,714,240 F432S probably damaging Het
Olfr1183 C T 2: 88,462,171 P296L probably damaging Het
Prmt5 G T 14: 54,507,856 T618K probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Serpinb7 A G 1: 107,428,307 D20G probably damaging Het
Slco1a4 T C 6: 141,812,741 I515V probably benign Het
Stk26 T A X: 50,887,926 Y283* probably null Het
Tanc1 A T 2: 59,843,884 K1778* probably null Het
Thada A G 17: 84,336,829 L1288P probably damaging Het
Ttbk2 C A 2: 120,748,821 V607F probably damaging Het
Other mutations in Hgfac
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00471:Hgfac APN 5 35046526 missense probably damaging 1.00
IGL01999:Hgfac APN 5 35044811 missense probably benign
IGL02133:Hgfac APN 5 35046587 missense probably damaging 1.00
IGL02314:Hgfac APN 5 35041597 start codon destroyed probably benign 0.21
IGL02337:Hgfac APN 5 35042378 missense probably benign 0.00
IGL02405:Hgfac APN 5 35044480 missense probably benign 0.19
IGL02451:Hgfac APN 5 35043814 splice site probably null
IGL02508:Hgfac APN 5 35047220 missense probably damaging 1.00
IGL02584:Hgfac APN 5 35043961 unclassified probably benign
IGL02986:Hgfac APN 5 35043863 missense probably benign 0.00
R0506:Hgfac UTSW 5 35044240 missense probably damaging 1.00
R1733:Hgfac UTSW 5 35043674 missense probably damaging 1.00
R1775:Hgfac UTSW 5 35042850 unclassified probably benign
R1871:Hgfac UTSW 5 35042913 makesense probably null
R3826:Hgfac UTSW 5 35048162 missense probably damaging 1.00
R4553:Hgfac UTSW 5 35042856 missense probably damaging 0.97
R5888:Hgfac UTSW 5 35045407 missense probably damaging 1.00
R5905:Hgfac UTSW 5 35042362 missense probably benign 0.20
R6017:Hgfac UTSW 5 35044395 missense probably damaging 1.00
R6056:Hgfac UTSW 5 35041629 nonsense probably null
R6124:Hgfac UTSW 5 35044384 missense probably benign 0.06
R7059:Hgfac UTSW 5 35044429 missense possibly damaging 0.49
R7232:Hgfac UTSW 5 35046914 missense probably damaging 1.00
R7555:Hgfac UTSW 5 35042628 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGAAAATCCTGTGAGCACCAGAGAC -3'
(R):5'- AGCTTGGACACAAAGAGCTGCC -3'

Sequencing Primer
(F):5'- TGTGAGCACCAGAGACTCTTG -3'
(R):5'- AGGGGTACTATGAGCATCCCTTC -3'
Posted On2013-07-30