Incidental Mutation 'R8057:Col4a4'
ID619420
Institutional Source Beutler Lab
Gene Symbol Col4a4
Ensembl Gene ENSMUSG00000067158
Gene Namecollagen, type IV, alpha 4
SynonymsE130010M05Rik, [a]4(IV)
MMRRC Submission
Accession Numbers

Genbank: NM_007735; MGI: 104687

Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R8057 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location82448423-82586849 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 82523870 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 387 (R387S)
Ref Sequence ENSEMBL: ENSMUSP00000084282 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087050]
Predicted Effect unknown
Transcript: ENSMUST00000087050
AA Change: R387S
SMART Domains Protein: ENSMUSP00000084282
Gene: ENSMUSG00000067158
AA Change: R387S

DomainStartEndE-ValueType
low complexity region 29 41 N/A INTRINSIC
Pfam:Collagen 54 113 4e-11 PFAM
Pfam:Collagen 110 168 4.1e-10 PFAM
Pfam:Collagen 172 229 2.8e-10 PFAM
low complexity region 265 288 N/A INTRINSIC
internal_repeat_7 289 345 1.46e-9 PROSPERO
internal_repeat_6 291 348 5.03e-10 PROSPERO
internal_repeat_9 297 353 7.22e-9 PROSPERO
internal_repeat_4 322 354 2.06e-11 PROSPERO
internal_repeat_11 334 349 1.25e-5 PROSPERO
Pfam:Collagen 392 449 1.3e-8 PFAM
low complexity region 461 482 N/A INTRINSIC
Pfam:Collagen 486 553 1e-10 PFAM
low complexity region 563 595 N/A INTRINSIC
Pfam:Collagen 597 658 1e-8 PFAM
Pfam:Collagen 663 731 4.4e-10 PFAM
Pfam:Collagen 755 810 3.3e-9 PFAM
internal_repeat_2 816 841 2.9e-13 PROSPERO
Pfam:Collagen 844 912 1.8e-10 PFAM
Pfam:Collagen 898 962 2.7e-10 PFAM
low complexity region 963 1003 N/A INTRINSIC
Pfam:Collagen 1006 1071 2e-10 PFAM
Pfam:Collagen 1073 1132 5.8e-12 PFAM
Pfam:Collagen 1124 1185 1.8e-10 PFAM
Pfam:Collagen 1187 1245 2.3e-8 PFAM
low complexity region 1277 1361 N/A INTRINSIC
low complexity region 1371 1384 N/A INTRINSIC
Pfam:Collagen 1395 1454 4.3e-8 PFAM
C4 1457 1564 3.36e-58 SMART
C4 1565 1681 1.49e-59 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (81/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the six subunits of type IV collagen, the major structural component of basement membranes. This particular collagen IV subunit, however, is only found in a subset of basement membranes. Like the other members of the type IV collagen gene family, this gene is organized in a head-to-head conformation with another type IV collagen gene so that each gene pair shares a common promoter. Mutations in this gene are associated with type II autosomal recessive Alport syndrome (hereditary glomerulonephropathy) and with familial benign hematuria (thin basement membrane disease). Two transcripts, differing only in their transcription start sites, have been identified for this gene and, as is common for collagen genes, multiple polyadenylation sites are found in the 3' UTR. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced mutation develop an early nephritic syndrome associated with uremia, proteinuria, hematuria, leukocyturia, and focal segmental glomerulosclerosis, and die prematurely of kidney failure. Some homozygotes exhibit moderatesensorineural hearing loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810013L24Rik C T 16: 8,830,368 probably benign Het
4930523C07Rik T C 1: 160,075,256 L32P probably damaging Het
4930563M21Rik T C 9: 56,009,280 T38A unknown Het
Abcb6 T C 1: 75,174,358 N563D probably damaging Het
Ak4 T C 4: 101,460,653 F140S probably damaging Het
Arhgap27 T A 11: 103,338,693 R296S probably damaging Het
Atxn7l1 A C 12: 33,326,002 K98N probably damaging Het
Bex6 G T 16: 32,186,406 D11Y probably damaging Het
Camta1 T C 4: 151,144,032 D781G probably damaging Het
Capn7 A G 14: 31,370,979 D800G probably benign Het
Carmil2 G A 8: 105,692,376 V716I probably benign Het
Cdk5 C A 5: 24,420,784 D144Y probably damaging Het
Cep85 T C 4: 134,153,614 probably benign Het
Chd5 T A 4: 152,366,372 L651Q probably damaging Het
Clcn7 C T 17: 25,149,259 Q261* probably null Het
Cntnap2 T A 6: 46,347,145 F576Y probably damaging Het
Col11a1 G A 3: 114,131,614 G815D unknown Het
Cse1l T A 2: 166,939,925 V663D probably damaging Het
Csf2rb2 G T 15: 78,285,006 Q650K probably damaging Het
Ctnnd2 A G 15: 30,847,351 D696G possibly damaging Het
D17Wsu92e C T 17: 27,767,889 A288T unknown Het
Dnah7c T A 1: 46,688,952 C2937S possibly damaging Het
Epha10 A T 4: 124,902,683 Q395L Het
Fam167a T A 14: 63,452,320 V22E probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Gabra4 A G 5: 71,623,952 I372T probably benign Het
Gm3550 T C 18: 34,737,529 F39L probably damaging Het
Gpt A G 15: 76,696,772 probably benign Het
H2-K1 C T 17: 33,996,859 G336D possibly damaging Het
Hoxd8 T C 2: 74,704,726 probably null Het
Kdm5d T G Y: 927,355 D658E possibly damaging Het
Krt25 G A 11: 99,317,343 T353M probably benign Het
Lonp2 T C 8: 86,714,089 L778P probably damaging Het
Lrrc66 G A 5: 73,607,532 Q723* probably null Het
Mak T A 13: 41,049,337 I212F probably damaging Het
Mastl T A 2: 23,133,554 R386W possibly damaging Het
Mis18bp1 A G 12: 65,148,899 I697T possibly damaging Het
Nek5 G A 8: 22,088,906 T415I probably benign Het
Neu3 T A 7: 99,814,228 N96I probably benign Het
Nxph2 T C 2: 23,400,095 V153A possibly damaging Het
Odf3l2 T A 10: 79,640,001 H243L probably damaging Het
Olfr1454 G A 19: 13,063,274 probably benign Het
Olfr518 A T 7: 108,881,364 F81I probably damaging Het
Olfr878 A G 9: 37,919,164 D169G probably benign Het
Otogl T C 10: 107,808,615 T1257A probably benign Het
Pcdh10 G A 3: 45,379,259 V3M probably benign Het
Pitpnm1 G A 19: 4,112,145 R1017Q probably null Het
Plcb3 A C 19: 6,955,095 H1065Q probably benign Het
Plcb3 A T 19: 6,958,899 M752K probably damaging Het
Plch1 T C 3: 63,698,136 E1449G probably benign Het
Plekha4 T A 7: 45,549,271 C573S probably benign Het
Plin2 T C 4: 86,657,401 I304V possibly damaging Het
Pnp2 G A 14: 50,964,381 V275I probably benign Het
Polr1a G A 6: 71,931,660 A490T possibly damaging Het
Ppp1r12b A G 1: 134,955,616 F56S probably damaging Het
Ptk2 GA G 15: 73,298,199 probably null Het
Rb1cc1 C A 1: 6,245,219 R473S probably damaging Het
Rcc2 G A 4: 140,702,275 C40Y probably benign Het
Rdx T C 9: 52,065,646 V65A probably damaging Het
Rps6ka5 A G 12: 100,573,796 probably null Het
Samd5 C T 10: 9,674,897 V23M probably damaging Het
Scn9a T G 2: 66,515,430 R1117S probably benign Het
Scrn1 T A 6: 54,520,773 I278L probably benign Het
Sec31b G T 19: 44,519,365 P747T probably damaging Het
Sipa1l2 A T 8: 125,468,530 V823E probably damaging Het
Slc2a13 T C 15: 91,516,416 N201S probably damaging Het
Slc30a3 C A 5: 31,090,051 probably benign Het
Snx31 C A 15: 36,523,460 V359F probably damaging Het
Sstr2 A G 11: 113,624,273 E6G probably benign Het
Stc2 C A 11: 31,367,806 E72* probably null Het
Tead1 C T 7: 112,759,514 P11L probably benign Het
Tmem51 T C 4: 142,031,748 T230A probably damaging Het
Tmem63c A T 12: 87,072,198 K301* probably null Het
Tns3 G C 11: 8,492,773 A530G probably benign Het
Trat1 T C 16: 48,742,237 D70G probably damaging Het
Trex1 T A 9: 109,058,329 E198V probably damaging Het
Ttn T G 2: 76,739,728 R26940S probably damaging Het
Uba2 T C 7: 34,168,410 K34R possibly damaging Het
Vps13d A C 4: 144,975,183 M4376R Het
Zfp157 C A 5: 138,456,074 T178K probably damaging Het
Zfp318 T A 17: 46,399,766 V805D possibly damaging Het
Other mutations in Col4a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Col4a4 APN 1 82491641 missense unknown
IGL01092:Col4a4 APN 1 82466545 missense unknown
IGL01104:Col4a4 APN 1 82466545 missense unknown
IGL01413:Col4a4 APN 1 82471248 missense unknown
IGL01518:Col4a4 APN 1 82455759 missense unknown
IGL02014:Col4a4 APN 1 82523960 splice site probably benign
IGL02215:Col4a4 APN 1 82453809 missense unknown
IGL02707:Col4a4 APN 1 82493516 missense unknown
IGL02858:Col4a4 APN 1 82528483 missense unknown
IGL02987:Col4a4 APN 1 82498925 splice site probably benign
IGL03384:Col4a4 APN 1 82484438 missense probably benign 0.04
amazement UTSW 1 82480486 nonsense probably null
aoba UTSW 1 82535740 critical splice donor site probably benign
asombro UTSW 1 82489009 critical splice donor site probably null
astonishment UTSW 1 82455728 missense unknown
wonderment UTSW 1 82453144 missense unknown
IGL02980:Col4a4 UTSW 1 82469477 critical splice donor site probably null
R0028:Col4a4 UTSW 1 82487510 critical splice donor site probably null
R0083:Col4a4 UTSW 1 82507111 critical splice acceptor site probably null
R0696:Col4a4 UTSW 1 82492549 missense unknown
R0788:Col4a4 UTSW 1 82524996 missense unknown
R0789:Col4a4 UTSW 1 82524996 missense unknown
R0790:Col4a4 UTSW 1 82524996 missense unknown
R0894:Col4a4 UTSW 1 82529656 splice site probably null
R1217:Col4a4 UTSW 1 82489009 critical splice donor site probably null
R1465:Col4a4 UTSW 1 82497822 splice site probably null
R1465:Col4a4 UTSW 1 82497822 splice site probably null
R1474:Col4a4 UTSW 1 82480486 nonsense probably null
R1508:Col4a4 UTSW 1 82455836 missense unknown
R1640:Col4a4 UTSW 1 82535770 missense unknown
R1678:Col4a4 UTSW 1 82486659 missense unknown
R1827:Col4a4 UTSW 1 82539988 missense unknown
R1930:Col4a4 UTSW 1 82466600 splice site probably null
R1931:Col4a4 UTSW 1 82466600 splice site probably null
R2092:Col4a4 UTSW 1 82498946 missense unknown
R2122:Col4a4 UTSW 1 82456871 missense unknown
R2132:Col4a4 UTSW 1 82497860 missense unknown
R2396:Col4a4 UTSW 1 82507072 missense unknown
R2418:Col4a4 UTSW 1 82532936 missense unknown
R2679:Col4a4 UTSW 1 82529611 missense unknown
R3085:Col4a4 UTSW 1 82529564 critical splice donor site probably null
R3437:Col4a4 UTSW 1 82497168 missense unknown
R3697:Col4a4 UTSW 1 82541237 missense unknown
R3730:Col4a4 UTSW 1 82455751 splice site probably null
R3752:Col4a4 UTSW 1 82480494 missense probably damaging 0.97
R4085:Col4a4 UTSW 1 82471188 critical splice donor site probably null
R4087:Col4a4 UTSW 1 82523922 missense unknown
R4088:Col4a4 UTSW 1 82523922 missense unknown
R4090:Col4a4 UTSW 1 82523922 missense unknown
R4213:Col4a4 UTSW 1 82453144 missense unknown
R4422:Col4a4 UTSW 1 82489838 missense unknown
R4596:Col4a4 UTSW 1 82471219 missense unknown
R4755:Col4a4 UTSW 1 82541174 missense unknown
R4757:Col4a4 UTSW 1 82528466 missense unknown
R4793:Col4a4 UTSW 1 82539099 missense unknown
R4812:Col4a4 UTSW 1 82462153 missense unknown
R4833:Col4a4 UTSW 1 82529602 missense unknown
R5259:Col4a4 UTSW 1 82453893 missense unknown
R5264:Col4a4 UTSW 1 82493591 missense unknown
R5265:Col4a4 UTSW 1 82493591 missense unknown
R5281:Col4a4 UTSW 1 82493591 missense unknown
R5283:Col4a4 UTSW 1 82493591 missense unknown
R5284:Col4a4 UTSW 1 82493591 missense unknown
R5387:Col4a4 UTSW 1 82493591 missense unknown
R5388:Col4a4 UTSW 1 82493591 missense unknown
R5435:Col4a4 UTSW 1 82454007 missense unknown
R5534:Col4a4 UTSW 1 82487517 missense unknown
R5666:Col4a4 UTSW 1 82485579 critical splice donor site probably null
R5670:Col4a4 UTSW 1 82485579 critical splice donor site probably null
R5943:Col4a4 UTSW 1 82525016 missense unknown
R5996:Col4a4 UTSW 1 82455728 missense unknown
R5999:Col4a4 UTSW 1 82492619 missense unknown
R6112:Col4a4 UTSW 1 82453883 missense unknown
R6192:Col4a4 UTSW 1 82484430 missense probably damaging 1.00
R6237:Col4a4 UTSW 1 82507031 missense unknown
R6419:Col4a4 UTSW 1 82466486 critical splice donor site probably null
R6458:Col4a4 UTSW 1 82455825 missense unknown
R6460:Col4a4 UTSW 1 82466532 missense unknown
R6481:Col4a4 UTSW 1 82453778 missense unknown
R6522:Col4a4 UTSW 1 82487583 missense unknown
R7000:Col4a4 UTSW 1 82497330 missense unknown
R7015:Col4a4 UTSW 1 82506950 missense unknown
R7055:Col4a4 UTSW 1 82519036 missense unknown
R7288:Col4a4 UTSW 1 82492463 missense unknown
R7293:Col4a4 UTSW 1 82523943 missense unknown
R7300:Col4a4 UTSW 1 82486640 missense unknown
R7458:Col4a4 UTSW 1 82498948 missense unknown
R7520:Col4a4 UTSW 1 82507087 nonsense probably null
R7727:Col4a4 UTSW 1 82528793 missense unknown
R7803:Col4a4 UTSW 1 82489698 critical splice donor site probably null
R7953:Col4a4 UTSW 1 82453968 missense unknown
R7959:Col4a4 UTSW 1 82507059 missense unknown
R7982:Col4a4 UTSW 1 82571441 start gained probably benign
R8000:Col4a4 UTSW 1 82541297 missense unknown
R8126:Col4a4 UTSW 1 82453286 missense unknown
R8406:Col4a4 UTSW 1 82523890 missense unknown
R8699:Col4a4 UTSW 1 82455734 missense unknown
R8835:Col4a4 UTSW 1 82469592 missense unknown
R8916:Col4a4 UTSW 1 82523946 missense unknown
R8921:Col4a4 UTSW 1 82453812 missense unknown
X0020:Col4a4 UTSW 1 82539952 critical splice donor site probably null
Z1088:Col4a4 UTSW 1 82453196 missense unknown
Predicted Primers PCR Primer
(F):5'- TAGAATTGAGGATTTCAGCTGGT -3'
(R):5'- ACTTAGACTGTACCAAGACTCACAA -3'

Sequencing Primer
(F):5'- TCCATTAGGATCCGACACTGGAG -3'
(R):5'- TGTACCAAGACTCACAAAAATTCCTG -3'
Posted On2020-01-23