Incidental Mutation 'R8057:Cse1l'
ID 619428
Institutional Source Beutler Lab
Gene Symbol Cse1l
Ensembl Gene ENSMUSG00000002718
Gene Name chromosome segregation 1 like
Synonyms Cas, Xpo2, Capts, 2610100P18Rik
MMRRC Submission 067494-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8057 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 166747961-166788309 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 166781845 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 663 (V663D)
Ref Sequence ENSEMBL: ENSMUSP00000002790 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002790] [ENSMUST00000163437] [ENSMUST00000168599] [ENSMUST00000169290]
AlphaFold Q9ERK4
Predicted Effect probably damaging
Transcript: ENSMUST00000002790
AA Change: V663D

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000002790
Gene: ENSMUSG00000002718
AA Change: V663D

DomainStartEndE-ValueType
IBN_N 29 102 2e-10 SMART
Pfam:Cse1 156 526 9.2e-169 PFAM
Pfam:CAS_CSE1 527 962 1.1e-181 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163437
AA Change: V350D

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000126757
Gene: ENSMUSG00000002718
AA Change: V350D

DomainStartEndE-ValueType
Pfam:Cse1 1 237 7.9e-105 PFAM
Pfam:CAS_CSE1 225 649 2.3e-195 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164974
SMART Domains Protein: ENSMUSP00000128515
Gene: ENSMUSG00000002718

DomainStartEndE-ValueType
Pfam:CAS_CSE1 24 72 5.4e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000168599
AA Change: V607D

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000129983
Gene: ENSMUSG00000002718
AA Change: V607D

DomainStartEndE-ValueType
IBN_N 29 102 2e-10 SMART
Pfam:Cse1 156 256 8.6e-40 PFAM
Pfam:Cse1 255 470 7.3e-99 PFAM
Pfam:CAS_CSE1 471 906 1.3e-201 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169290
SMART Domains Protein: ENSMUSP00000128376
Gene: ENSMUSG00000002718

DomainStartEndE-ValueType
IBN_N 29 102 2e-10 SMART
Pfam:Cse1 156 389 5.2e-102 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (81/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Proteins that carry a nuclear localization signal (NLS) are transported into the nucleus by the importin-alpha/beta heterodimer. Importin-alpha binds the NLS, while importin-beta mediates translocation through the nuclear pore complex. After translocation, RanGTP binds importin-beta and displaces importin-alpha. Importin-alpha must then be returned to the cytoplasm, leaving the NLS protein behind. The protein encoded by this gene binds strongly to NLS-free importin-alpha, and this binding is released in the cytoplasm by the combined action of RANBP1 and RANGAP1. In addition, the encoded protein may play a role both in apoptosis and in cell proliferation. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Embryos homozygous for a targeted null mutation die prior to E5.5 of development and are morphologically disorganized and lack identifiable structures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930523C07Rik T C 1: 159,902,826 (GRCm39) L32P probably damaging Het
4930563M21Rik T C 9: 55,916,564 (GRCm39) T38A unknown Het
Abcb6 T C 1: 75,151,002 (GRCm39) N563D probably damaging Het
Ak4 T C 4: 101,317,850 (GRCm39) F140S probably damaging Het
Arhgap27 T A 11: 103,229,519 (GRCm39) R296S probably damaging Het
Atxn7l1 A C 12: 33,376,001 (GRCm39) K98N probably damaging Het
Bex6 G T 16: 32,005,224 (GRCm39) D11Y probably damaging Het
Camta1 T C 4: 151,228,489 (GRCm39) D781G probably damaging Het
Capn7 A G 14: 31,092,936 (GRCm39) D800G probably benign Het
Carmil2 G A 8: 106,419,008 (GRCm39) V716I probably benign Het
Cdk5 C A 5: 24,625,782 (GRCm39) D144Y probably damaging Het
Cep85 T C 4: 133,880,925 (GRCm39) probably benign Het
Chd5 T A 4: 152,450,829 (GRCm39) L651Q probably damaging Het
Cimap1d T A 10: 79,475,835 (GRCm39) H243L probably damaging Het
Clcn7 C T 17: 25,368,233 (GRCm39) Q261* probably null Het
Cntnap2 T A 6: 46,324,079 (GRCm39) F576Y probably damaging Het
Col11a1 G A 3: 113,925,263 (GRCm39) G815D unknown Het
Col4a4 T A 1: 82,501,591 (GRCm39) R387S unknown Het
Csf2rb2 G T 15: 78,169,206 (GRCm39) Q650K probably damaging Het
Ctnnd2 A G 15: 30,847,497 (GRCm39) D696G possibly damaging Het
Dnah7c T A 1: 46,728,112 (GRCm39) C2937S possibly damaging Het
Epha10 A T 4: 124,796,476 (GRCm39) Q395L Het
Fam167a T A 14: 63,689,769 (GRCm39) V22E probably benign Het
Fan1 T A 7: 64,022,234 (GRCm39) N340Y probably damaging Het
Gabra4 A G 5: 71,781,295 (GRCm39) I372T probably benign Het
Gpt A G 15: 76,580,972 (GRCm39) probably benign Het
H2-K2 C T 17: 34,215,833 (GRCm39) G336D possibly damaging Het
Hapstr1 C T 16: 8,648,232 (GRCm39) probably benign Het
Hoxd8 T C 2: 74,535,070 (GRCm39) probably null Het
Ilrun C T 17: 27,986,863 (GRCm39) A288T unknown Het
Kdm5d T G Y: 927,355 (GRCm39) D658E possibly damaging Het
Krt25 G A 11: 99,208,169 (GRCm39) T353M probably benign Het
Lonp2 T C 8: 87,440,717 (GRCm39) L778P probably damaging Het
Lrrc66 G A 5: 73,764,875 (GRCm39) Q723* probably null Het
Mak T A 13: 41,202,813 (GRCm39) I212F probably damaging Het
Mastl T A 2: 23,023,566 (GRCm39) R386W possibly damaging Het
Mis18bp1 A G 12: 65,195,673 (GRCm39) I697T possibly damaging Het
Nek5 G A 8: 22,578,922 (GRCm39) T415I probably benign Het
Neu3 T A 7: 99,463,435 (GRCm39) N96I probably benign Het
Nxph2 T C 2: 23,290,107 (GRCm39) V153A possibly damaging Het
Or10a3 A T 7: 108,480,571 (GRCm39) F81I probably damaging Het
Or5b102 G A 19: 13,040,638 (GRCm39) probably benign Het
Or8b4 A G 9: 37,830,460 (GRCm39) D169G probably benign Het
Otogl T C 10: 107,644,476 (GRCm39) T1257A probably benign Het
Pcdh10 G A 3: 45,333,694 (GRCm39) V3M probably benign Het
Pitpnm1 G A 19: 4,162,145 (GRCm39) R1017Q probably null Het
Plcb3 A C 19: 6,932,463 (GRCm39) H1065Q probably benign Het
Plcb3 A T 19: 6,936,267 (GRCm39) M752K probably damaging Het
Plch1 T C 3: 63,605,557 (GRCm39) E1449G probably benign Het
Plekha4 T A 7: 45,198,695 (GRCm39) C573S probably benign Het
Plin2 T C 4: 86,575,638 (GRCm39) I304V possibly damaging Het
Pnp2 G A 14: 51,201,838 (GRCm39) V275I probably benign Het
Polr1a G A 6: 71,908,644 (GRCm39) A490T possibly damaging Het
Ppp1r12b A G 1: 134,883,354 (GRCm39) F56S probably damaging Het
Ptk2 GA G 15: 73,170,048 (GRCm39) probably null Het
Rb1cc1 C A 1: 6,315,443 (GRCm39) R473S probably damaging Het
Rcc2 G A 4: 140,429,586 (GRCm39) C40Y probably benign Het
Rdx T C 9: 51,976,946 (GRCm39) V65A probably damaging Het
Rpl27rt T C 18: 34,870,582 (GRCm39) F39L probably damaging Het
Rps6ka5 A G 12: 100,540,055 (GRCm39) probably null Het
Samd5 C T 10: 9,550,641 (GRCm39) V23M probably damaging Het
Scn9a T G 2: 66,345,774 (GRCm39) R1117S probably benign Het
Scrn1 T A 6: 54,497,758 (GRCm39) I278L probably benign Het
Sec31b G T 19: 44,507,804 (GRCm39) P747T probably damaging Het
Sipa1l2 A T 8: 126,195,269 (GRCm39) V823E probably damaging Het
Slc2a13 T C 15: 91,400,619 (GRCm39) N201S probably damaging Het
Slc30a3 C A 5: 31,247,395 (GRCm39) probably benign Het
Snx31 C A 15: 36,523,606 (GRCm39) V359F probably damaging Het
Sstr2 A G 11: 113,515,099 (GRCm39) E6G probably benign Het
Stc2 C A 11: 31,317,806 (GRCm39) E72* probably null Het
Tead1 C T 7: 112,358,721 (GRCm39) P11L probably benign Het
Tmem51 T C 4: 141,759,059 (GRCm39) T230A probably damaging Het
Tmem63c A T 12: 87,118,972 (GRCm39) K301* probably null Het
Tns3 G C 11: 8,442,773 (GRCm39) A530G probably benign Het
Trat1 T C 16: 48,562,600 (GRCm39) D70G probably damaging Het
Trex1 T A 9: 108,887,397 (GRCm39) E198V probably damaging Het
Ttn T G 2: 76,570,072 (GRCm39) R26940S probably damaging Het
Uba2 T C 7: 33,867,835 (GRCm39) K34R possibly damaging Het
Vps13d A C 4: 144,701,753 (GRCm39) M4376R Het
Zfp157 C A 5: 138,454,336 (GRCm39) T178K probably damaging Het
Zfp318 T A 17: 46,710,692 (GRCm39) V805D possibly damaging Het
Other mutations in Cse1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Cse1l APN 2 166,769,724 (GRCm39) missense probably damaging 1.00
IGL01306:Cse1l APN 2 166,769,428 (GRCm39) nonsense probably null
IGL01672:Cse1l APN 2 166,771,887 (GRCm39) missense probably damaging 1.00
IGL02060:Cse1l APN 2 166,772,573 (GRCm39) missense probably damaging 1.00
IGL02897:Cse1l APN 2 166,761,628 (GRCm39) missense possibly damaging 0.47
IGL03375:Cse1l APN 2 166,784,977 (GRCm39) splice site probably benign
ANU23:Cse1l UTSW 2 166,769,428 (GRCm39) nonsense probably null
PIT4585001:Cse1l UTSW 2 166,783,394 (GRCm39) missense probably damaging 1.00
R0195:Cse1l UTSW 2 166,782,008 (GRCm39) missense probably benign
R1114:Cse1l UTSW 2 166,783,123 (GRCm39) splice site probably benign
R1539:Cse1l UTSW 2 166,768,292 (GRCm39) missense probably benign 0.00
R1721:Cse1l UTSW 2 166,768,331 (GRCm39) missense probably damaging 1.00
R1779:Cse1l UTSW 2 166,782,044 (GRCm39) splice site probably null
R1913:Cse1l UTSW 2 166,764,111 (GRCm39) missense probably damaging 1.00
R2069:Cse1l UTSW 2 166,783,412 (GRCm39) missense probably benign 0.01
R2398:Cse1l UTSW 2 166,770,917 (GRCm39) missense probably damaging 1.00
R4110:Cse1l UTSW 2 166,783,970 (GRCm39) missense probably benign 0.00
R4195:Cse1l UTSW 2 166,771,899 (GRCm39) missense probably damaging 1.00
R4603:Cse1l UTSW 2 166,786,452 (GRCm39) missense probably benign 0.09
R4686:Cse1l UTSW 2 166,774,080 (GRCm39) missense probably damaging 1.00
R4867:Cse1l UTSW 2 166,768,323 (GRCm39) missense possibly damaging 0.76
R4942:Cse1l UTSW 2 166,771,714 (GRCm39) missense probably damaging 1.00
R5164:Cse1l UTSW 2 166,786,348 (GRCm39) missense probably benign 0.02
R5475:Cse1l UTSW 2 166,783,174 (GRCm39) missense probably damaging 1.00
R5493:Cse1l UTSW 2 166,783,110 (GRCm39) intron probably benign
R5782:Cse1l UTSW 2 166,770,921 (GRCm39) missense probably damaging 1.00
R5862:Cse1l UTSW 2 166,757,127 (GRCm39) missense probably benign 0.00
R6030:Cse1l UTSW 2 166,761,541 (GRCm39) missense probably benign 0.01
R6030:Cse1l UTSW 2 166,761,541 (GRCm39) missense probably benign 0.01
R6913:Cse1l UTSW 2 166,771,797 (GRCm39) missense possibly damaging 0.65
R7683:Cse1l UTSW 2 166,764,708 (GRCm39) missense probably benign
R7871:Cse1l UTSW 2 166,777,591 (GRCm39) splice site probably null
R8001:Cse1l UTSW 2 166,781,833 (GRCm39) missense probably damaging 1.00
R8175:Cse1l UTSW 2 166,785,128 (GRCm39) critical splice donor site probably null
R8347:Cse1l UTSW 2 166,769,505 (GRCm39) missense possibly damaging 0.95
R8386:Cse1l UTSW 2 166,761,604 (GRCm39) missense probably benign 0.00
R8479:Cse1l UTSW 2 166,763,893 (GRCm39) missense possibly damaging 0.95
R8973:Cse1l UTSW 2 166,785,000 (GRCm39) missense probably damaging 1.00
R9206:Cse1l UTSW 2 166,783,185 (GRCm39) missense probably damaging 1.00
R9208:Cse1l UTSW 2 166,783,185 (GRCm39) missense probably damaging 1.00
R9522:Cse1l UTSW 2 166,776,673 (GRCm39) missense probably benign
R9599:Cse1l UTSW 2 166,783,386 (GRCm39) missense probably benign
R9600:Cse1l UTSW 2 166,757,119 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAAAGCTAACCCTGCTGC -3'
(R):5'- AGTTGCTATTGTACTTGAGCCTCG -3'

Sequencing Primer
(F):5'- AAAGCTAACCCTGCTGCTGTTG -3'
(R):5'- CCTCGTTCTAAGAATGCCTGGAG -3'
Posted On 2020-01-23