Incidental Mutation 'R8057:Vps13d'
ID619437
Institutional Source Beutler Lab
Gene Symbol Vps13d
Ensembl Gene ENSMUSG00000020220
Gene Namevacuolar protein sorting 13D
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8057 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location144972622-145195005 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 144975183 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 4376 (M4376R)
Ref Sequence ENSEMBL: ENSMUSP00000043240 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020441] [ENSMUST00000036579] [ENSMUST00000130704]
Predicted Effect probably benign
Transcript: ENSMUST00000020441
AA Change: M4345R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000020441
Gene: ENSMUSG00000020220
AA Change: M4345R

DomainStartEndE-ValueType
Pfam:Chorein_N 2 118 1.8e-37 PFAM
low complexity region 407 423 N/A INTRINSIC
low complexity region 534 555 N/A INTRINSIC
coiled coil region 665 685 N/A INTRINSIC
low complexity region 765 781 N/A INTRINSIC
low complexity region 1316 1329 N/A INTRINSIC
low complexity region 1590 1603 N/A INTRINSIC
Blast:IL1 1605 1726 2e-6 BLAST
low complexity region 1868 1883 N/A INTRINSIC
low complexity region 2128 2141 N/A INTRINSIC
UBA 2632 2669 3.73e-5 SMART
low complexity region 2674 2684 N/A INTRINSIC
low complexity region 2707 2718 N/A INTRINSIC
low complexity region 2866 2884 N/A INTRINSIC
low complexity region 2973 2983 N/A INTRINSIC
Pfam:DUF1162 3246 3530 1.1e-110 PFAM
low complexity region 3797 3810 N/A INTRINSIC
low complexity region 3913 3921 N/A INTRINSIC
low complexity region 4119 4132 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000043240
Gene: ENSMUSG00000020220
AA Change: M4376R

DomainStartEndE-ValueType
Pfam:Chorein_N 2 116 3.5e-35 PFAM
Pfam:VPS13 131 353 9.6e-57 PFAM
low complexity region 407 423 N/A INTRINSIC
low complexity region 534 555 N/A INTRINSIC
Pfam:VPS13_mid_rpt 608 896 4.3e-35 PFAM
low complexity region 1316 1329 N/A INTRINSIC
low complexity region 1590 1603 N/A INTRINSIC
Blast:IL1 1605 1726 2e-6 BLAST
low complexity region 1868 1883 N/A INTRINSIC
low complexity region 2128 2141 N/A INTRINSIC
UBA 2632 2669 3.73e-5 SMART
low complexity region 2674 2684 N/A INTRINSIC
low complexity region 2707 2718 N/A INTRINSIC
low complexity region 2891 2909 N/A INTRINSIC
low complexity region 2998 3008 N/A INTRINSIC
Pfam:SHR-BD 3271 3555 4.2e-86 PFAM
low complexity region 3822 3835 N/A INTRINSIC
low complexity region 3938 3946 N/A INTRINSIC
Pfam:VPS13_C 3978 4126 4.8e-24 PFAM
low complexity region 4144 4157 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130704
SMART Domains Protein: ENSMUSP00000118699
Gene: ENSMUSG00000020220

DomainStartEndE-ValueType
Pfam:DUF1162 162 446 1.4e-111 PFAM
low complexity region 713 726 N/A INTRINSIC
low complexity region 829 837 N/A INTRINSIC
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the vacuolar-protein-sorting-13 gene family. In yeast, vacuolar-protein-sorting-13 proteins are involved in trafficking of membrane proteins between the trans-Golgi network and the prevacuolar compartment. While several transcript variants may exist for this gene, the full-length natures of only two have been described to date. These two represent the major variants of this gene and encode distinct isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810013L24Rik C T 16: 8,830,368 probably benign Het
4930523C07Rik T C 1: 160,075,256 L32P probably damaging Het
4930563M21Rik T C 9: 56,009,280 T38A unknown Het
Abcb6 T C 1: 75,174,358 N563D probably damaging Het
Ak4 T C 4: 101,460,653 F140S probably damaging Het
Arhgap27 T A 11: 103,338,693 R296S probably damaging Het
Atxn7l1 A C 12: 33,326,002 K98N probably damaging Het
Bex6 G T 16: 32,186,406 D11Y probably damaging Het
Camta1 T C 4: 151,144,032 D781G probably damaging Het
Capn7 A G 14: 31,370,979 D800G probably benign Het
Carmil2 G A 8: 105,692,376 V716I probably benign Het
Cdk5 C A 5: 24,420,784 D144Y probably damaging Het
Chd5 T A 4: 152,366,372 L651Q probably damaging Het
Clcn7 C T 17: 25,149,259 Q261* probably null Het
Cntnap2 T A 6: 46,347,145 F576Y probably damaging Het
Col11a1 G A 3: 114,131,614 G815D unknown Het
Col4a4 T A 1: 82,523,870 R387S unknown Het
Cse1l T A 2: 166,939,925 V663D probably damaging Het
Csf2rb2 G T 15: 78,285,006 Q650K probably damaging Het
Ctnnd2 A G 15: 30,847,351 D696G possibly damaging Het
D17Wsu92e C T 17: 27,767,889 A288T unknown Het
Dnah7c T A 1: 46,688,952 C2937S possibly damaging Het
Epha10 A T 4: 124,902,683 Q395L Het
Fam167a T A 14: 63,452,320 V22E probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Gabra4 A G 5: 71,623,952 I372T probably benign Het
Gm3550 T C 18: 34,737,529 F39L probably damaging Het
Gpt A G 15: 76,696,772 probably benign Het
H2-K1 C T 17: 33,996,859 G336D possibly damaging Het
Hoxd8 T C 2: 74,704,726 probably null Het
Kdm5d T G Y: 927,355 D658E possibly damaging Het
Krt25 G A 11: 99,317,343 T353M probably benign Het
Lonp2 T C 8: 86,714,089 L778P probably damaging Het
Lrrc66 G A 5: 73,607,532 Q723* probably null Het
Mak T A 13: 41,049,337 I212F probably damaging Het
Mastl T A 2: 23,133,554 R386W possibly damaging Het
Mis18bp1 A G 12: 65,148,899 I697T possibly damaging Het
Nek5 G A 8: 22,088,906 T415I probably benign Het
Neu3 T A 7: 99,814,228 N96I probably benign Het
Nxph2 T C 2: 23,400,095 V153A possibly damaging Het
Odf3l2 T A 10: 79,640,001 H243L probably damaging Het
Olfr1454 G A 19: 13,063,274 probably benign Het
Olfr518 A T 7: 108,881,364 F81I probably damaging Het
Olfr878 A G 9: 37,919,164 D169G probably benign Het
Otogl T C 10: 107,808,615 T1257A probably benign Het
Pcdh10 G A 3: 45,379,259 V3M probably benign Het
Pitpnm1 G A 19: 4,112,145 R1017Q probably null Het
Plcb3 A C 19: 6,955,095 H1065Q probably benign Het
Plcb3 A T 19: 6,958,899 M752K probably damaging Het
Plch1 T C 3: 63,698,136 E1449G probably benign Het
Plekha4 T A 7: 45,549,271 C573S probably benign Het
Plin2 T C 4: 86,657,401 I304V possibly damaging Het
Pnp2 G A 14: 50,964,381 V275I probably benign Het
Polr1a G A 6: 71,931,660 A490T possibly damaging Het
Ppp1r12b A G 1: 134,955,616 F56S probably damaging Het
Ptk2 GA G 15: 73,298,199 probably null Het
Rb1cc1 C A 1: 6,245,219 R473S probably damaging Het
Rcc2 G A 4: 140,702,275 C40Y probably benign Het
Rdx T C 9: 52,065,646 V65A probably damaging Het
Rps6ka5 A G 12: 100,573,796 probably null Het
Samd5 C T 10: 9,674,897 V23M probably damaging Het
Scn9a T G 2: 66,515,430 R1117S probably benign Het
Scrn1 T A 6: 54,520,773 I278L probably benign Het
Sec31b G T 19: 44,519,365 P747T probably damaging Het
Sipa1l2 A T 8: 125,468,530 V823E probably damaging Het
Slc2a13 T C 15: 91,516,416 N201S probably damaging Het
Snx31 C A 15: 36,523,460 V359F probably damaging Het
Sstr2 A G 11: 113,624,273 E6G probably benign Het
Stc2 C A 11: 31,367,806 E72* probably null Het
Tead1 C T 7: 112,759,514 P11L probably benign Het
Tmem51 T C 4: 142,031,748 T230A probably damaging Het
Tmem63c A T 12: 87,072,198 K301* probably null Het
Tns3 G C 11: 8,492,773 A530G probably benign Het
Trat1 T C 16: 48,742,237 D70G probably damaging Het
Trex1 T A 9: 109,058,329 E198V probably damaging Het
Ttn T G 2: 76,739,728 R26940S probably damaging Het
Uba2 T C 7: 34,168,410 K34R possibly damaging Het
Zfp157 C A 5: 138,456,074 T178K probably damaging Het
Zfp318 T A 17: 46,399,766 V805D possibly damaging Het
Other mutations in Vps13d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Vps13d APN 4 145168540 missense probably damaging 0.98
IGL00484:Vps13d APN 4 145126575 missense probably benign 0.04
IGL00591:Vps13d APN 4 145190559 missense possibly damaging 0.95
IGL00816:Vps13d APN 4 145155994 missense probably benign 0.00
IGL00835:Vps13d APN 4 145160652 missense probably damaging 0.97
IGL00847:Vps13d APN 4 145085408 missense probably benign 0.26
IGL01084:Vps13d APN 4 145154955 missense probably benign 0.00
IGL01116:Vps13d APN 4 144972750 unclassified probably benign
IGL01150:Vps13d APN 4 145149275 missense probably benign
IGL01329:Vps13d APN 4 145156206 missense possibly damaging 0.69
IGL01338:Vps13d APN 4 145088322 missense probably damaging 1.00
IGL01583:Vps13d APN 4 145045088 missense probably damaging 1.00
IGL01598:Vps13d APN 4 145016901 missense probably benign 0.21
IGL01620:Vps13d APN 4 145094867 missense possibly damaging 0.70
IGL01636:Vps13d APN 4 145075048 missense probably damaging 1.00
IGL01723:Vps13d APN 4 145173145 missense possibly damaging 0.84
IGL01895:Vps13d APN 4 145156266 missense possibly damaging 0.57
IGL01981:Vps13d APN 4 145086747 missense probably damaging 0.99
IGL02192:Vps13d APN 4 145148858 missense probably benign 0.02
IGL02197:Vps13d APN 4 145128309 missense probably benign 0.01
IGL02209:Vps13d APN 4 145156101 missense probably damaging 0.97
IGL02219:Vps13d APN 4 145168146 missense probably benign 0.00
IGL02377:Vps13d APN 4 145156364 missense probably damaging 1.00
IGL02404:Vps13d APN 4 145148735 missense probably damaging 1.00
IGL02552:Vps13d APN 4 145173137 missense possibly damaging 0.46
IGL02651:Vps13d APN 4 145164559 missense probably benign 0.02
IGL02708:Vps13d APN 4 145128280 missense probably benign 0.12
IGL02811:Vps13d APN 4 145131765 missense possibly damaging 0.55
IGL02821:Vps13d APN 4 145148762 missense probably damaging 0.98
IGL02838:Vps13d APN 4 145075025 missense probably benign 0.31
IGL02968:Vps13d APN 4 145122498 missense probably benign 0.32
IGL03176:Vps13d APN 4 145074963 missense probably benign 0.16
IGL03352:Vps13d APN 4 145167502 missense possibly damaging 0.49
IGL03374:Vps13d APN 4 145108575 missense possibly damaging 0.70
IGL03375:Vps13d APN 4 145091947 missense probably damaging 1.00
IGL03383:Vps13d APN 4 145168319 critical splice acceptor site probably null
IGL03411:Vps13d APN 4 145149324 missense probably damaging 1.00
PIT4283001:Vps13d UTSW 4 145108588 missense
PIT4434001:Vps13d UTSW 4 145155247 missense
R0069:Vps13d UTSW 4 145062563 missense probably benign 0.09
R0069:Vps13d UTSW 4 145062563 missense probably benign 0.09
R0076:Vps13d UTSW 4 145164694 splice site probably benign
R0211:Vps13d UTSW 4 145114778 missense probably benign 0.08
R0219:Vps13d UTSW 4 145105909 missense probably benign 0.01
R0284:Vps13d UTSW 4 145144802 missense probably benign 0.01
R0345:Vps13d UTSW 4 145117625 missense possibly damaging 0.81
R0400:Vps13d UTSW 4 145065827 missense probably benign 0.00
R0417:Vps13d UTSW 4 144976560 missense probably benign 0.19
R0538:Vps13d UTSW 4 145045095 missense probably damaging 1.00
R0560:Vps13d UTSW 4 145054190 missense probably damaging 1.00
R0627:Vps13d UTSW 4 145087184 missense probably damaging 1.00
R0707:Vps13d UTSW 4 145155932 missense probably damaging 1.00
R0782:Vps13d UTSW 4 145126625 splice site probably benign
R0925:Vps13d UTSW 4 145156551 missense probably damaging 1.00
R0993:Vps13d UTSW 4 145117692 nonsense probably null
R1135:Vps13d UTSW 4 145155589 missense probably benign 0.01
R1165:Vps13d UTSW 4 145126471 missense probably benign
R1263:Vps13d UTSW 4 145170348 missense probably benign 0.01
R1397:Vps13d UTSW 4 145141334 missense probably damaging 1.00
R1398:Vps13d UTSW 4 145099983 missense probably null
R1521:Vps13d UTSW 4 145105861 missense probably benign 0.00
R1522:Vps13d UTSW 4 145098172 splice site probably null
R1725:Vps13d UTSW 4 145143260 missense possibly damaging 0.90
R1759:Vps13d UTSW 4 145155857 missense probably benign
R1826:Vps13d UTSW 4 145155003 missense probably damaging 0.96
R1900:Vps13d UTSW 4 145126606 missense probably benign 0.23
R1943:Vps13d UTSW 4 145155857 missense probably benign
R1955:Vps13d UTSW 4 145156143 missense probably damaging 1.00
R2008:Vps13d UTSW 4 145155243 missense probably benign 0.00
R2013:Vps13d UTSW 4 145108508 missense probably damaging 0.99
R2014:Vps13d UTSW 4 145108508 missense probably damaging 0.99
R2038:Vps13d UTSW 4 145181115 critical splice donor site probably null
R2108:Vps13d UTSW 4 145075047 missense probably damaging 0.99
R2130:Vps13d UTSW 4 145156101 missense probably benign 0.17
R2134:Vps13d UTSW 4 145148339 missense probably benign 0.00
R2168:Vps13d UTSW 4 145087323 splice site probably benign
R2220:Vps13d UTSW 4 145178320 missense probably damaging 1.00
R2240:Vps13d UTSW 4 145110895 missense possibly damaging 0.70
R2332:Vps13d UTSW 4 145148686 missense probably benign
R2357:Vps13d UTSW 4 145074977 frame shift probably null
R2365:Vps13d UTSW 4 145087324 splice site probably benign
R2571:Vps13d UTSW 4 145149136 missense probably benign 0.20
R3149:Vps13d UTSW 4 145126577 missense possibly damaging 0.70
R3150:Vps13d UTSW 4 145086790 missense probably damaging 0.98
R3547:Vps13d UTSW 4 145074975 missense probably damaging 0.99
R3716:Vps13d UTSW 4 145075726 missense probably damaging 1.00
R3718:Vps13d UTSW 4 145075726 missense probably damaging 1.00
R3725:Vps13d UTSW 4 145115648 splice site probably benign
R3794:Vps13d UTSW 4 145085437 splice site probably benign
R3875:Vps13d UTSW 4 145190544 missense probably damaging 1.00
R3948:Vps13d UTSW 4 145141340 missense probably damaging 1.00
R3953:Vps13d UTSW 4 145148880 missense probably damaging 1.00
R4021:Vps13d UTSW 4 145075061 missense possibly damaging 0.90
R4323:Vps13d UTSW 4 145152778 missense probably benign 0.28
R4346:Vps13d UTSW 4 145072529 intron probably benign
R4509:Vps13d UTSW 4 145062602 missense probably damaging 1.00
R4613:Vps13d UTSW 4 145131655 missense possibly damaging 0.95
R4657:Vps13d UTSW 4 145074842 missense probably damaging 1.00
R4680:Vps13d UTSW 4 145108510 missense possibly damaging 0.94
R4688:Vps13d UTSW 4 145178212 missense probably benign
R4797:Vps13d UTSW 4 145054155 missense probably damaging 1.00
R4798:Vps13d UTSW 4 145178056 missense probably damaging 0.98
R4817:Vps13d UTSW 4 145069165 missense probably damaging 1.00
R4839:Vps13d UTSW 4 145085430 missense possibly damaging 0.95
R4860:Vps13d UTSW 4 145087161 missense probably benign
R4860:Vps13d UTSW 4 145087161 missense probably benign
R4869:Vps13d UTSW 4 145128042 missense probably damaging 1.00
R4904:Vps13d UTSW 4 145155445 missense probably damaging 1.00
R4912:Vps13d UTSW 4 145155857 missense probably benign
R4916:Vps13d UTSW 4 144983393 missense probably damaging 1.00
R4976:Vps13d UTSW 4 145105898 missense possibly damaging 0.82
R5029:Vps13d UTSW 4 145156282 missense probably benign 0.02
R5049:Vps13d UTSW 4 145086766 missense probably damaging 1.00
R5077:Vps13d UTSW 4 145088241 missense probably damaging 0.98
R5119:Vps13d UTSW 4 145105898 missense possibly damaging 0.82
R5227:Vps13d UTSW 4 145181207 splice site probably null
R5291:Vps13d UTSW 4 145062569 missense probably damaging 0.99
R5344:Vps13d UTSW 4 145178334 missense probably damaging 0.98
R5348:Vps13d UTSW 4 145065889 missense probably damaging 0.99
R5478:Vps13d UTSW 4 145167550 missense probably damaging 0.99
R5632:Vps13d UTSW 4 145074882 missense probably damaging 0.99
R5642:Vps13d UTSW 4 145170302 missense possibly damaging 0.66
R5712:Vps13d UTSW 4 145087173 missense probably benign 0.07
R5747:Vps13d UTSW 4 145168283 missense probably benign 0.00
R5752:Vps13d UTSW 4 145148970 missense probably benign 0.06
R5804:Vps13d UTSW 4 145100070 missense probably benign 0.03
R5917:Vps13d UTSW 4 145100010 missense probably damaging 0.96
R5932:Vps13d UTSW 4 145045041 missense possibly damaging 0.71
R5940:Vps13d UTSW 4 145074975 missense probably benign 0.09
R5978:Vps13d UTSW 4 145122611 missense probably benign
R6031:Vps13d UTSW 4 145168509 missense probably benign 0.01
R6031:Vps13d UTSW 4 145168509 missense probably benign 0.01
R6143:Vps13d UTSW 4 145148565 missense possibly damaging 0.95
R6174:Vps13d UTSW 4 144975193 nonsense probably null
R6191:Vps13d UTSW 4 145149348 missense probably damaging 1.00
R6198:Vps13d UTSW 4 145148990 missense probably benign 0.28
R6374:Vps13d UTSW 4 145122681 missense probably damaging 1.00
R6379:Vps13d UTSW 4 145088258 missense probably benign
R6388:Vps13d UTSW 4 145155574 missense probably benign 0.06
R6418:Vps13d UTSW 4 145092280 missense probably damaging 0.98
R6466:Vps13d UTSW 4 145057495 missense possibly damaging 0.47
R6602:Vps13d UTSW 4 145103664 intron probably benign
R6604:Vps13d UTSW 4 145181124 missense probably damaging 1.00
R7051:Vps13d UTSW 4 145163344 missense probably benign 0.00
R7052:Vps13d UTSW 4 145163344 missense probably benign 0.00
R7103:Vps13d UTSW 4 145115492 missense
R7231:Vps13d UTSW 4 145057462 missense
R7246:Vps13d UTSW 4 145156050 missense
R7339:Vps13d UTSW 4 145121368 missense
R7409:Vps13d UTSW 4 145141254 missense
R7419:Vps13d UTSW 4 145115503 missense
R7424:Vps13d UTSW 4 145148747 missense
R7439:Vps13d UTSW 4 145105856 missense
R7440:Vps13d UTSW 4 145128411 missense
R7528:Vps13d UTSW 4 145091922 missense
R7547:Vps13d UTSW 4 145057538 missense
R7558:Vps13d UTSW 4 145154580 missense
R7729:Vps13d UTSW 4 145075052 missense
R7789:Vps13d UTSW 4 145100065 missense
R7813:Vps13d UTSW 4 145178063 nonsense probably null
R7834:Vps13d UTSW 4 145108573 missense
R7840:Vps13d UTSW 4 145103676 missense
R7880:Vps13d UTSW 4 145181114 critical splice donor site probably null
R7912:Vps13d UTSW 4 145173127 missense
R7917:Vps13d UTSW 4 145108573 missense
R7923:Vps13d UTSW 4 145103676 missense
R7963:Vps13d UTSW 4 145181114 critical splice donor site probably null
R7993:Vps13d UTSW 4 145173127 missense
R8021:Vps13d UTSW 4 145148675 missense
R8048:Vps13d UTSW 4 145155567 missense
R8063:Vps13d UTSW 4 145114757 missense
R8131:Vps13d UTSW 4 145156137 missense
X0021:Vps13d UTSW 4 145155025 missense probably damaging 0.99
Z1176:Vps13d UTSW 4 145107067 missense
Z1177:Vps13d UTSW 4 145154908 missense
Z1177:Vps13d UTSW 4 145178296 missense
Predicted Primers PCR Primer
(F):5'- TGCCCCACAAACTAATATGGTTTC -3'
(R):5'- GTCACAGGTCCCTGAGAATCTC -3'

Sequencing Primer
(F):5'- CTGTGAGAATTTCTTTCCCCTTG -3'
(R):5'- ACAGGTCCCTGAGAATCTCTTTATC -3'
Posted On2020-01-23