Incidental Mutation 'R8057:Gabra4'
ID619441
Institutional Source Beutler Lab
Gene Symbol Gabra4
Ensembl Gene ENSMUSG00000029211
Gene Namegamma-aminobutyric acid (GABA) A receptor, subunit alpha 4
SynonymsGabra-4
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8057 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location71569749-71658308 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 71623952 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 372 (I372T)
Ref Sequence ENSEMBL: ENSMUSP00000143675 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031121] [ENSMUST00000197994] [ENSMUST00000198138] [ENSMUST00000199357]
Predicted Effect probably benign
Transcript: ENSMUST00000031121
AA Change: I346T

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000031121
Gene: ENSMUSG00000029211
AA Change: I346T

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Neur_chan_LBD 48 256 8.8e-52 PFAM
Pfam:Neur_chan_memb 263 536 3.4e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197994
Predicted Effect probably benign
Transcript: ENSMUST00000198138
SMART Domains Protein: ENSMUSP00000142466
Gene: ENSMUSG00000029211

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
SCOP:d1i9ba_ 53 69 3e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199357
AA Change: I372T

PolyPhen 2 Score 0.120 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000143675
Gene: ENSMUSG00000029211
AA Change: I372T

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Neur_chan_LBD 91 282 1.7e-45 PFAM
Pfam:Neur_chan_memb 289 562 3.3e-44 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (81/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Gamma-aminobutyric acid (GABA) is the major inhibitory neurotransmitter in the mammalian brain where it acts at GABA-A receptors, which are ligand-gated chloride channels. Chloride conductance of these channels can be modulated by agents such as benzodiazepines that bind to the GABA-A receptor. At least 16 distinct subunits of GABA-A receptors have been identified. This gene encodes subunit alpha-4, which is involved in the etiology of autism and eventually increases autism risk through interaction with another subunit, gamma-aminobutyric acid receptor beta-1 (GABRB1). Alternatively spliced transcript variants encoding different isoforms have been found in this gene.[provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous mutation of this gene does not appear to result in a phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810013L24Rik C T 16: 8,830,368 probably benign Het
4930523C07Rik T C 1: 160,075,256 L32P probably damaging Het
4930563M21Rik T C 9: 56,009,280 T38A unknown Het
Abcb6 T C 1: 75,174,358 N563D probably damaging Het
Ak4 T C 4: 101,460,653 F140S probably damaging Het
Arhgap27 T A 11: 103,338,693 R296S probably damaging Het
Atxn7l1 A C 12: 33,326,002 K98N probably damaging Het
Bex6 G T 16: 32,186,406 D11Y probably damaging Het
Camta1 T C 4: 151,144,032 D781G probably damaging Het
Capn7 A G 14: 31,370,979 D800G probably benign Het
Carmil2 G A 8: 105,692,376 V716I probably benign Het
Cdk5 C A 5: 24,420,784 D144Y probably damaging Het
Cep85 T C 4: 134,153,614 probably benign Het
Chd5 T A 4: 152,366,372 L651Q probably damaging Het
Clcn7 C T 17: 25,149,259 Q261* probably null Het
Cntnap2 T A 6: 46,347,145 F576Y probably damaging Het
Col11a1 G A 3: 114,131,614 G815D unknown Het
Col4a4 T A 1: 82,523,870 R387S unknown Het
Cse1l T A 2: 166,939,925 V663D probably damaging Het
Csf2rb2 G T 15: 78,285,006 Q650K probably damaging Het
Ctnnd2 A G 15: 30,847,351 D696G possibly damaging Het
D17Wsu92e C T 17: 27,767,889 A288T unknown Het
Dnah7c T A 1: 46,688,952 C2937S possibly damaging Het
Epha10 A T 4: 124,902,683 Q395L Het
Fam167a T A 14: 63,452,320 V22E probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Gm3550 T C 18: 34,737,529 F39L probably damaging Het
Gpt A G 15: 76,696,772 probably benign Het
H2-K1 C T 17: 33,996,859 G336D possibly damaging Het
Hoxd8 T C 2: 74,704,726 probably null Het
Kdm5d T G Y: 927,355 D658E possibly damaging Het
Krt25 G A 11: 99,317,343 T353M probably benign Het
Lonp2 T C 8: 86,714,089 L778P probably damaging Het
Lrrc66 G A 5: 73,607,532 Q723* probably null Het
Mak T A 13: 41,049,337 I212F probably damaging Het
Mastl T A 2: 23,133,554 R386W possibly damaging Het
Mis18bp1 A G 12: 65,148,899 I697T possibly damaging Het
Nek5 G A 8: 22,088,906 T415I probably benign Het
Neu3 T A 7: 99,814,228 N96I probably benign Het
Nxph2 T C 2: 23,400,095 V153A possibly damaging Het
Odf3l2 T A 10: 79,640,001 H243L probably damaging Het
Olfr1454 G A 19: 13,063,274 probably benign Het
Olfr518 A T 7: 108,881,364 F81I probably damaging Het
Olfr878 A G 9: 37,919,164 D169G probably benign Het
Otogl T C 10: 107,808,615 T1257A probably benign Het
Pcdh10 G A 3: 45,379,259 V3M probably benign Het
Pitpnm1 G A 19: 4,112,145 R1017Q probably null Het
Plcb3 A C 19: 6,955,095 H1065Q probably benign Het
Plcb3 A T 19: 6,958,899 M752K probably damaging Het
Plch1 T C 3: 63,698,136 E1449G probably benign Het
Plekha4 T A 7: 45,549,271 C573S probably benign Het
Plin2 T C 4: 86,657,401 I304V possibly damaging Het
Pnp2 G A 14: 50,964,381 V275I probably benign Het
Polr1a G A 6: 71,931,660 A490T possibly damaging Het
Ppp1r12b A G 1: 134,955,616 F56S probably damaging Het
Ptk2 GA G 15: 73,298,199 probably null Het
Rb1cc1 C A 1: 6,245,219 R473S probably damaging Het
Rcc2 G A 4: 140,702,275 C40Y probably benign Het
Rdx T C 9: 52,065,646 V65A probably damaging Het
Rps6ka5 A G 12: 100,573,796 probably null Het
Samd5 C T 10: 9,674,897 V23M probably damaging Het
Scn9a T G 2: 66,515,430 R1117S probably benign Het
Scrn1 T A 6: 54,520,773 I278L probably benign Het
Sec31b G T 19: 44,519,365 P747T probably damaging Het
Sipa1l2 A T 8: 125,468,530 V823E probably damaging Het
Slc2a13 T C 15: 91,516,416 N201S probably damaging Het
Slc30a3 C A 5: 31,090,051 probably benign Het
Snx31 C A 15: 36,523,460 V359F probably damaging Het
Sstr2 A G 11: 113,624,273 E6G probably benign Het
Stc2 C A 11: 31,367,806 E72* probably null Het
Tead1 C T 7: 112,759,514 P11L probably benign Het
Tmem51 T C 4: 142,031,748 T230A probably damaging Het
Tmem63c A T 12: 87,072,198 K301* probably null Het
Tns3 G C 11: 8,492,773 A530G probably benign Het
Trat1 T C 16: 48,742,237 D70G probably damaging Het
Trex1 T A 9: 109,058,329 E198V probably damaging Het
Ttn T G 2: 76,739,728 R26940S probably damaging Het
Uba2 T C 7: 34,168,410 K34R possibly damaging Het
Vps13d A C 4: 144,975,183 M4376R Het
Zfp157 C A 5: 138,456,074 T178K probably damaging Het
Zfp318 T A 17: 46,399,766 V805D possibly damaging Het
Other mutations in Gabra4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01111:Gabra4 APN 5 71633629 missense probably damaging 1.00
IGL01503:Gabra4 APN 5 71641086 missense possibly damaging 0.60
IGL02028:Gabra4 APN 5 71633596 missense probably damaging 1.00
IGL02688:Gabra4 APN 5 71572167 missense probably benign
IGL02749:Gabra4 APN 5 71638147 missense probably benign 0.42
IGL03095:Gabra4 APN 5 71624015 missense probably damaging 1.00
IGL03330:Gabra4 APN 5 71641064 missense probably null 1.00
E0354:Gabra4 UTSW 5 71640861 missense probably damaging 1.00
PIT4142001:Gabra4 UTSW 5 71571763 missense probably damaging 1.00
R1523:Gabra4 UTSW 5 71633632 missense probably damaging 1.00
R1622:Gabra4 UTSW 5 71571986 missense possibly damaging 0.57
R1689:Gabra4 UTSW 5 71633542 splice site probably null
R1930:Gabra4 UTSW 5 71638237 missense probably damaging 1.00
R1931:Gabra4 UTSW 5 71638237 missense probably damaging 1.00
R1967:Gabra4 UTSW 5 71572069 missense possibly damaging 0.87
R2095:Gabra4 UTSW 5 71624112 missense probably damaging 0.99
R2131:Gabra4 UTSW 5 71641224 missense probably benign 0.00
R2698:Gabra4 UTSW 5 71572078 missense probably benign 0.03
R3884:Gabra4 UTSW 5 71657257 missense probably benign 0.33
R3924:Gabra4 UTSW 5 71642253 splice site probably benign
R4029:Gabra4 UTSW 5 71572189 missense probably benign 0.31
R4361:Gabra4 UTSW 5 71633545 critical splice donor site probably null
R4659:Gabra4 UTSW 5 71641144 missense probably damaging 1.00
R4682:Gabra4 UTSW 5 71657809 start codon destroyed probably null 0.74
R4810:Gabra4 UTSW 5 71623982 missense probably damaging 1.00
R4888:Gabra4 UTSW 5 71572203 missense probably benign 0.01
R5093:Gabra4 UTSW 5 71640864 missense probably damaging 1.00
R5121:Gabra4 UTSW 5 71572203 missense probably benign 0.01
R5889:Gabra4 UTSW 5 71571891 missense possibly damaging 0.61
R5906:Gabra4 UTSW 5 71623910 missense probably benign 0.00
R6574:Gabra4 UTSW 5 71623925 missense probably benign
R7068:Gabra4 UTSW 5 71572059 missense probably benign 0.07
R7571:Gabra4 UTSW 5 71571992 missense probably benign
R7815:Gabra4 UTSW 5 71657809 start codon destroyed possibly damaging 0.54
R7817:Gabra4 UTSW 5 71640863 missense probably damaging 1.00
R7840:Gabra4 UTSW 5 71640913 splice site probably null
R7899:Gabra4 UTSW 5 71657995 unclassified probably benign
R8000:Gabra4 UTSW 5 71623961 missense probably damaging 1.00
Z1176:Gabra4 UTSW 5 71623895 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- GCTCTCTGTTTTCTACTACAACAAA -3'
(R):5'- ATTCCTCTCTCGAAGGTGGTG -3'

Sequencing Primer
(F):5'- AAAAATTGACCAAGCAGATAAAACC -3'
(R):5'- ATTAGTAACTTCATCAACTGCATCCC -3'
Posted On2020-01-23