Incidental Mutation 'R8057:Polr1a'
ID 619446
Institutional Source Beutler Lab
Gene Symbol Polr1a
Ensembl Gene ENSMUSG00000049553
Gene Name polymerase (RNA) I polypeptide A
Synonyms 2900087K15Rik, 3010014K16Rik, 194kDa, mRPA1, Rpo1-4, RPA194
MMRRC Submission 067494-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8057 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 71886037-71956419 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 71908644 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 490 (A490T)
Ref Sequence ENSEMBL: ENSMUSP00000060858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055296] [ENSMUST00000206556]
AlphaFold O35134
Predicted Effect possibly damaging
Transcript: ENSMUST00000055296
AA Change: A490T

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000060858
Gene: ENSMUSG00000049553
AA Change: A490T

DomainStartEndE-ValueType
RPOLA_N 302 649 8.97e-137 SMART
Pfam:RNA_pol_Rpb1_4 846 958 1.3e-26 PFAM
Pfam:RNA_pol_Rpb1_5 965 1669 7e-103 PFAM
low complexity region 1698 1708 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206556
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (81/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the largest subunit of the RNA polymerase I complex. The encoded protein represents the catalytic subunit of the complex, which transcribes DNA into ribosomal RNA precursors. Defects in this gene are a cause of the Cincinnati type of acrofacial dysostosis. [provided by RefSeq, May 2016]
Allele List at MGI

All alleles(18) : Gene trapped(18)

Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930523C07Rik T C 1: 159,902,826 (GRCm39) L32P probably damaging Het
4930563M21Rik T C 9: 55,916,564 (GRCm39) T38A unknown Het
Abcb6 T C 1: 75,151,002 (GRCm39) N563D probably damaging Het
Ak4 T C 4: 101,317,850 (GRCm39) F140S probably damaging Het
Arhgap27 T A 11: 103,229,519 (GRCm39) R296S probably damaging Het
Atxn7l1 A C 12: 33,376,001 (GRCm39) K98N probably damaging Het
Bex6 G T 16: 32,005,224 (GRCm39) D11Y probably damaging Het
Camta1 T C 4: 151,228,489 (GRCm39) D781G probably damaging Het
Capn7 A G 14: 31,092,936 (GRCm39) D800G probably benign Het
Carmil2 G A 8: 106,419,008 (GRCm39) V716I probably benign Het
Cdk5 C A 5: 24,625,782 (GRCm39) D144Y probably damaging Het
Cep85 T C 4: 133,880,925 (GRCm39) probably benign Het
Chd5 T A 4: 152,450,829 (GRCm39) L651Q probably damaging Het
Cimap1d T A 10: 79,475,835 (GRCm39) H243L probably damaging Het
Clcn7 C T 17: 25,368,233 (GRCm39) Q261* probably null Het
Cntnap2 T A 6: 46,324,079 (GRCm39) F576Y probably damaging Het
Col11a1 G A 3: 113,925,263 (GRCm39) G815D unknown Het
Col4a4 T A 1: 82,501,591 (GRCm39) R387S unknown Het
Cse1l T A 2: 166,781,845 (GRCm39) V663D probably damaging Het
Csf2rb2 G T 15: 78,169,206 (GRCm39) Q650K probably damaging Het
Ctnnd2 A G 15: 30,847,497 (GRCm39) D696G possibly damaging Het
Dnah7c T A 1: 46,728,112 (GRCm39) C2937S possibly damaging Het
Epha10 A T 4: 124,796,476 (GRCm39) Q395L Het
Fam167a T A 14: 63,689,769 (GRCm39) V22E probably benign Het
Fan1 T A 7: 64,022,234 (GRCm39) N340Y probably damaging Het
Gabra4 A G 5: 71,781,295 (GRCm39) I372T probably benign Het
Gpt A G 15: 76,580,972 (GRCm39) probably benign Het
H2-K2 C T 17: 34,215,833 (GRCm39) G336D possibly damaging Het
Hapstr1 C T 16: 8,648,232 (GRCm39) probably benign Het
Hoxd8 T C 2: 74,535,070 (GRCm39) probably null Het
Ilrun C T 17: 27,986,863 (GRCm39) A288T unknown Het
Kdm5d T G Y: 927,355 (GRCm39) D658E possibly damaging Het
Krt25 G A 11: 99,208,169 (GRCm39) T353M probably benign Het
Lonp2 T C 8: 87,440,717 (GRCm39) L778P probably damaging Het
Lrrc66 G A 5: 73,764,875 (GRCm39) Q723* probably null Het
Mak T A 13: 41,202,813 (GRCm39) I212F probably damaging Het
Mastl T A 2: 23,023,566 (GRCm39) R386W possibly damaging Het
Mis18bp1 A G 12: 65,195,673 (GRCm39) I697T possibly damaging Het
Nek5 G A 8: 22,578,922 (GRCm39) T415I probably benign Het
Neu3 T A 7: 99,463,435 (GRCm39) N96I probably benign Het
Nxph2 T C 2: 23,290,107 (GRCm39) V153A possibly damaging Het
Or10a3 A T 7: 108,480,571 (GRCm39) F81I probably damaging Het
Or5b102 G A 19: 13,040,638 (GRCm39) probably benign Het
Or8b4 A G 9: 37,830,460 (GRCm39) D169G probably benign Het
Otogl T C 10: 107,644,476 (GRCm39) T1257A probably benign Het
Pcdh10 G A 3: 45,333,694 (GRCm39) V3M probably benign Het
Pitpnm1 G A 19: 4,162,145 (GRCm39) R1017Q probably null Het
Plcb3 A C 19: 6,932,463 (GRCm39) H1065Q probably benign Het
Plcb3 A T 19: 6,936,267 (GRCm39) M752K probably damaging Het
Plch1 T C 3: 63,605,557 (GRCm39) E1449G probably benign Het
Plekha4 T A 7: 45,198,695 (GRCm39) C573S probably benign Het
Plin2 T C 4: 86,575,638 (GRCm39) I304V possibly damaging Het
Pnp2 G A 14: 51,201,838 (GRCm39) V275I probably benign Het
Ppp1r12b A G 1: 134,883,354 (GRCm39) F56S probably damaging Het
Ptk2 GA G 15: 73,170,048 (GRCm39) probably null Het
Rb1cc1 C A 1: 6,315,443 (GRCm39) R473S probably damaging Het
Rcc2 G A 4: 140,429,586 (GRCm39) C40Y probably benign Het
Rdx T C 9: 51,976,946 (GRCm39) V65A probably damaging Het
Rpl27rt T C 18: 34,870,582 (GRCm39) F39L probably damaging Het
Rps6ka5 A G 12: 100,540,055 (GRCm39) probably null Het
Samd5 C T 10: 9,550,641 (GRCm39) V23M probably damaging Het
Scn9a T G 2: 66,345,774 (GRCm39) R1117S probably benign Het
Scrn1 T A 6: 54,497,758 (GRCm39) I278L probably benign Het
Sec31b G T 19: 44,507,804 (GRCm39) P747T probably damaging Het
Sipa1l2 A T 8: 126,195,269 (GRCm39) V823E probably damaging Het
Slc2a13 T C 15: 91,400,619 (GRCm39) N201S probably damaging Het
Slc30a3 C A 5: 31,247,395 (GRCm39) probably benign Het
Snx31 C A 15: 36,523,606 (GRCm39) V359F probably damaging Het
Sstr2 A G 11: 113,515,099 (GRCm39) E6G probably benign Het
Stc2 C A 11: 31,317,806 (GRCm39) E72* probably null Het
Tead1 C T 7: 112,358,721 (GRCm39) P11L probably benign Het
Tmem51 T C 4: 141,759,059 (GRCm39) T230A probably damaging Het
Tmem63c A T 12: 87,118,972 (GRCm39) K301* probably null Het
Tns3 G C 11: 8,442,773 (GRCm39) A530G probably benign Het
Trat1 T C 16: 48,562,600 (GRCm39) D70G probably damaging Het
Trex1 T A 9: 108,887,397 (GRCm39) E198V probably damaging Het
Ttn T G 2: 76,570,072 (GRCm39) R26940S probably damaging Het
Uba2 T C 7: 33,867,835 (GRCm39) K34R possibly damaging Het
Vps13d A C 4: 144,701,753 (GRCm39) M4376R Het
Zfp157 C A 5: 138,454,336 (GRCm39) T178K probably damaging Het
Zfp318 T A 17: 46,710,692 (GRCm39) V805D possibly damaging Het
Other mutations in Polr1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01363:Polr1a APN 6 71,925,470 (GRCm39) missense probably benign 0.32
IGL01834:Polr1a APN 6 71,925,446 (GRCm39) missense probably benign
IGL01902:Polr1a APN 6 71,940,732 (GRCm39) missense probably damaging 1.00
IGL02101:Polr1a APN 6 71,927,786 (GRCm39) missense probably benign 0.00
IGL02325:Polr1a APN 6 71,897,641 (GRCm39) missense probably benign 0.38
IGL02398:Polr1a APN 6 71,913,540 (GRCm39) splice site probably benign
IGL02528:Polr1a APN 6 71,941,701 (GRCm39) missense probably benign
IGL02555:Polr1a APN 6 71,897,441 (GRCm39) missense probably damaging 0.98
IGL02613:Polr1a APN 6 71,944,304 (GRCm39) missense probably damaging 1.00
IGL02693:Polr1a APN 6 71,940,830 (GRCm39) splice site probably benign
IGL02892:Polr1a APN 6 71,908,680 (GRCm39) missense possibly damaging 0.70
IGL03059:Polr1a APN 6 71,913,496 (GRCm39) missense probably benign
IGL03174:Polr1a APN 6 71,954,331 (GRCm39) missense possibly damaging 0.82
D4043:Polr1a UTSW 6 71,918,401 (GRCm39) missense possibly damaging 0.92
R0092:Polr1a UTSW 6 71,944,439 (GRCm39) splice site probably benign
R0217:Polr1a UTSW 6 71,940,687 (GRCm39) missense probably benign 0.19
R0267:Polr1a UTSW 6 71,951,123 (GRCm39) missense probably damaging 0.99
R0329:Polr1a UTSW 6 71,943,400 (GRCm39) missense possibly damaging 0.96
R0330:Polr1a UTSW 6 71,943,400 (GRCm39) missense possibly damaging 0.96
R0352:Polr1a UTSW 6 71,897,747 (GRCm39) splice site probably benign
R0411:Polr1a UTSW 6 71,955,405 (GRCm39) missense possibly damaging 0.95
R0446:Polr1a UTSW 6 71,927,648 (GRCm39) critical splice donor site probably null
R0846:Polr1a UTSW 6 71,901,627 (GRCm39) missense probably damaging 1.00
R1035:Polr1a UTSW 6 71,944,900 (GRCm39) missense probably benign
R1294:Polr1a UTSW 6 71,889,886 (GRCm39) missense probably damaging 0.99
R1460:Polr1a UTSW 6 71,918,368 (GRCm39) missense probably damaging 0.99
R1657:Polr1a UTSW 6 71,918,519 (GRCm39) missense probably damaging 1.00
R1846:Polr1a UTSW 6 71,953,172 (GRCm39) missense probably damaging 0.98
R1862:Polr1a UTSW 6 71,886,187 (GRCm39) missense probably damaging 0.96
R1865:Polr1a UTSW 6 71,943,508 (GRCm39) missense probably damaging 1.00
R1903:Polr1a UTSW 6 71,944,898 (GRCm39) missense probably benign 0.02
R1937:Polr1a UTSW 6 71,913,536 (GRCm39) critical splice donor site probably null
R2063:Polr1a UTSW 6 71,913,269 (GRCm39) splice site probably null
R2071:Polr1a UTSW 6 71,953,058 (GRCm39) missense possibly damaging 0.64
R2084:Polr1a UTSW 6 71,927,793 (GRCm39) missense possibly damaging 0.69
R2377:Polr1a UTSW 6 71,949,810 (GRCm39) critical splice donor site probably null
R2410:Polr1a UTSW 6 71,951,866 (GRCm39) missense probably benign
R3001:Polr1a UTSW 6 71,890,000 (GRCm39) missense probably benign 0.01
R3001:Polr1a UTSW 6 71,942,628 (GRCm39) missense probably benign 0.02
R3002:Polr1a UTSW 6 71,942,628 (GRCm39) missense probably benign 0.02
R3002:Polr1a UTSW 6 71,890,000 (GRCm39) missense probably benign 0.01
R3924:Polr1a UTSW 6 71,906,434 (GRCm39) missense probably benign 0.00
R4105:Polr1a UTSW 6 71,953,175 (GRCm39) missense probably damaging 0.98
R4125:Polr1a UTSW 6 71,942,690 (GRCm39) missense probably benign 0.00
R4271:Polr1a UTSW 6 71,930,006 (GRCm39) missense probably benign 0.02
R4440:Polr1a UTSW 6 71,927,832 (GRCm39) missense probably damaging 0.98
R4667:Polr1a UTSW 6 71,894,805 (GRCm39) missense probably benign 0.30
R4769:Polr1a UTSW 6 71,927,852 (GRCm39) missense probably benign 0.01
R4801:Polr1a UTSW 6 71,953,054 (GRCm39) missense probably benign 0.00
R4802:Polr1a UTSW 6 71,953,054 (GRCm39) missense probably benign 0.00
R4828:Polr1a UTSW 6 71,943,385 (GRCm39) missense possibly damaging 0.93
R4911:Polr1a UTSW 6 71,886,213 (GRCm39) missense possibly damaging 0.67
R5071:Polr1a UTSW 6 71,908,693 (GRCm39) missense possibly damaging 0.71
R5165:Polr1a UTSW 6 71,944,909 (GRCm39) missense probably damaging 1.00
R5223:Polr1a UTSW 6 71,944,891 (GRCm39) missense possibly damaging 0.73
R5239:Polr1a UTSW 6 71,890,021 (GRCm39) missense probably damaging 1.00
R5546:Polr1a UTSW 6 71,906,350 (GRCm39) missense possibly damaging 0.64
R5599:Polr1a UTSW 6 71,944,346 (GRCm39) missense possibly damaging 0.95
R5696:Polr1a UTSW 6 71,906,410 (GRCm39) missense probably benign 0.05
R5850:Polr1a UTSW 6 71,903,667 (GRCm39) missense probably benign 0.00
R6274:Polr1a UTSW 6 71,931,874 (GRCm39) splice site probably null
R6526:Polr1a UTSW 6 71,906,427 (GRCm39) missense possibly damaging 0.89
R6578:Polr1a UTSW 6 71,953,025 (GRCm39) missense possibly damaging 0.93
R6660:Polr1a UTSW 6 71,944,358 (GRCm39) missense probably damaging 0.98
R6892:Polr1a UTSW 6 71,941,696 (GRCm39) missense possibly damaging 0.72
R7274:Polr1a UTSW 6 71,897,500 (GRCm39) nonsense probably null
R7291:Polr1a UTSW 6 71,918,440 (GRCm39) missense probably benign 0.02
R7311:Polr1a UTSW 6 71,927,863 (GRCm39) missense possibly damaging 0.53
R7431:Polr1a UTSW 6 71,903,643 (GRCm39) missense probably benign 0.14
R7479:Polr1a UTSW 6 71,913,281 (GRCm39) missense probably damaging 1.00
R7607:Polr1a UTSW 6 71,890,005 (GRCm39) missense probably benign
R7739:Polr1a UTSW 6 71,931,819 (GRCm39) missense possibly damaging 0.94
R7746:Polr1a UTSW 6 71,918,496 (GRCm39) missense probably damaging 1.00
R7764:Polr1a UTSW 6 71,930,054 (GRCm39) missense probably damaging 1.00
R7835:Polr1a UTSW 6 71,892,126 (GRCm39) missense probably benign 0.02
R8029:Polr1a UTSW 6 71,889,940 (GRCm39) nonsense probably null
R8144:Polr1a UTSW 6 71,927,600 (GRCm39) missense probably benign
R8170:Polr1a UTSW 6 71,897,733 (GRCm39) missense probably benign
R8320:Polr1a UTSW 6 71,918,368 (GRCm39) missense probably damaging 0.99
R8328:Polr1a UTSW 6 71,897,718 (GRCm39) missense probably benign
R8331:Polr1a UTSW 6 71,953,163 (GRCm39) missense probably damaging 1.00
R8362:Polr1a UTSW 6 71,941,651 (GRCm39) missense probably benign 0.00
R8511:Polr1a UTSW 6 71,897,504 (GRCm39) missense probably benign 0.01
R8709:Polr1a UTSW 6 71,951,832 (GRCm39) missense probably benign
R8745:Polr1a UTSW 6 71,931,755 (GRCm39) missense probably damaging 1.00
R8784:Polr1a UTSW 6 71,927,612 (GRCm39) missense probably benign
R9055:Polr1a UTSW 6 71,892,053 (GRCm39) missense possibly damaging 0.46
R9088:Polr1a UTSW 6 71,908,767 (GRCm39) missense probably benign 0.26
R9211:Polr1a UTSW 6 71,943,521 (GRCm39) missense probably damaging 1.00
R9228:Polr1a UTSW 6 71,931,755 (GRCm39) missense probably damaging 1.00
R9240:Polr1a UTSW 6 71,940,661 (GRCm39) nonsense probably null
R9267:Polr1a UTSW 6 71,942,542 (GRCm39) missense probably benign
R9302:Polr1a UTSW 6 71,901,683 (GRCm39) critical splice donor site probably null
R9744:Polr1a UTSW 6 71,906,372 (GRCm39) missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AGCTCTCCACAGTTTGGGAAG -3'
(R):5'- GCAGCAAGTTGGAACCAGAC -3'

Sequencing Primer
(F):5'- GAAACCAGGCAGCTCATTTTG -3'
(R):5'- CTAGGAAGTTATGAACAAACCCATG -3'
Posted On 2020-01-23