Mutagenetix > Incidental Mutation

Incidental Mutation 'R8057:Sipa1l2'

619456

Institutional Source

Beutler Lab

Gene Symbol

Sipa1l2

Ensembl Gene

ENSMUSG00000001995

Gene Name

signal-induced proliferation-associated 1 like 2

Synonyms

MMRRC Submission

067494-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.324) question?

Stock #

R8057 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

125418063-125569808 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 125468530 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 823 (V823E)

Ref Sequence

ENSEMBL: ENSMUSP00000104405 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000108775] [ENSMUST00000212168] [ENSMUST00000212987]

AlphaFold

Q80TE4

Predicted Effect

probably damaging
Transcript: ENSMUST00000108775
AA Change: V823E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000104405
Gene: ENSMUSG00000001995
AA Change: V823E

Domain	Start	End	E-Value	Type
low complexity region	53	64	N/A	INTRINSIC
low complexity region	163	172	N/A	INTRINSIC
low complexity region	261	272	N/A	INTRINSIC
low complexity region	427	449	N/A	INTRINSIC
Pfam:Rap_GAP	625	807	2.6e-67	PFAM
PDZ	960	1026	6.47e-9	SMART
low complexity region	1091	1103	N/A	INTRINSIC
low complexity region	1120	1138	N/A	INTRINSIC
low complexity region	1220	1238	N/A	INTRINSIC
low complexity region	1299	1312	N/A	INTRINSIC
low complexity region	1321	1329	N/A	INTRINSIC
low complexity region	1334	1355	N/A	INTRINSIC
low complexity region	1404	1418	N/A	INTRINSIC
Pfam:SPAR_C	1421	1666	2.5e-76	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000212168
AA Change: V823E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

probably damaging
Transcript: ENSMUST00000212987
AA Change: V823E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

100% (81/81)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the signal-induced proliferation-associated 1 like family. Members of this family contain a GTPase activating domain, a PDZ domain and a C-terminal coiled-coil domain with a leucine zipper. A similar protein in rat acts as a GTPases for the small GTPase Rap. [provided by RefSeq, Sep 2015]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810013L24Rik	C	T	16: 8,830,368		probably benign	Het
4930523C07Rik	T	C	1: 160,075,256	L32P	probably damaging	Het
4930563M21Rik	T	C	9: 56,009,280	T38A	unknown	Het
Abcb6	T	C	1: 75,174,358	N563D	probably damaging	Het
Ak4	T	C	4: 101,460,653	F140S	probably damaging	Het
Arhgap27	T	A	11: 103,338,693	R296S	probably damaging	Het
Atxn7l1	A	C	12: 33,326,002	K98N	probably damaging	Het
Bex6	G	T	16: 32,186,406	D11Y	probably damaging	Het
Camta1	T	C	4: 151,144,032	D781G	probably damaging	Het
Capn7	A	G	14: 31,370,979	D800G	probably benign	Het
Carmil2	G	A	8: 105,692,376	V716I	probably benign	Het
Cdk5	C	A	5: 24,420,784	D144Y	probably damaging	Het
Cep85	T	C	4: 134,153,614		probably benign	Het
Chd5	T	A	4: 152,366,372	L651Q	probably damaging	Het
Clcn7	C	T	17: 25,149,259	Q261*	probably null	Het
Cntnap2	T	A	6: 46,347,145	F576Y	probably damaging	Het
Col11a1	G	A	3: 114,131,614	G815D	unknown	Het
Col4a4	T	A	1: 82,523,870	R387S	unknown	Het
Cse1l	T	A	2: 166,939,925	V663D	probably damaging	Het
Csf2rb2	G	T	15: 78,285,006	Q650K	probably damaging	Het
Ctnnd2	A	G	15: 30,847,351	D696G	possibly damaging	Het
D17Wsu92e	C	T	17: 27,767,889	A288T	unknown	Het
Dnah7c	T	A	1: 46,688,952	C2937S	possibly damaging	Het
Epha10	A	T	4: 124,902,683	Q395L		Het
Fam167a	T	A	14: 63,452,320	V22E	probably benign	Het
Fan1	T	A	7: 64,372,486	N340Y	probably damaging	Het
Gabra4	A	G	5: 71,623,952	I372T	probably benign	Het
Gm3550	T	C	18: 34,737,529	F39L	probably damaging	Het
Gpt	A	G	15: 76,696,772		probably benign	Het
H2-K1	C	T	17: 33,996,859	G336D	possibly damaging	Het
Hoxd8	T	C	2: 74,704,726		probably null	Het
Kdm5d	T	G	Y: 927,355	D658E	possibly damaging	Het
Krt25	G	A	11: 99,317,343	T353M	probably benign	Het
Lonp2	T	C	8: 86,714,089	L778P	probably damaging	Het
Lrrc66	G	A	5: 73,607,532	Q723*	probably null	Het
Mak	T	A	13: 41,049,337	I212F	probably damaging	Het
Mastl	T	A	2: 23,133,554	R386W	possibly damaging	Het
Mis18bp1	A	G	12: 65,148,899	I697T	possibly damaging	Het
Nek5	G	A	8: 22,088,906	T415I	probably benign	Het
Neu3	T	A	7: 99,814,228	N96I	probably benign	Het
Nxph2	T	C	2: 23,400,095	V153A	possibly damaging	Het
Odf3l2	T	A	10: 79,640,001	H243L	probably damaging	Het
Olfr1454	G	A	19: 13,063,274		probably benign	Het
Olfr518	A	T	7: 108,881,364	F81I	probably damaging	Het
Olfr878	A	G	9: 37,919,164	D169G	probably benign	Het
Otogl	T	C	10: 107,808,615	T1257A	probably benign	Het
Pcdh10	G	A	3: 45,379,259	V3M	probably benign	Het
Pitpnm1	G	A	19: 4,112,145	R1017Q	probably null	Het
Plcb3	A	C	19: 6,955,095	H1065Q	probably benign	Het
Plcb3	A	T	19: 6,958,899	M752K	probably damaging	Het
Plch1	T	C	3: 63,698,136	E1449G	probably benign	Het
Plekha4	T	A	7: 45,549,271	C573S	probably benign	Het
Plin2	T	C	4: 86,657,401	I304V	possibly damaging	Het
Pnp2	G	A	14: 50,964,381	V275I	probably benign	Het
Polr1a	G	A	6: 71,931,660	A490T	possibly damaging	Het
Ppp1r12b	A	G	1: 134,955,616	F56S	probably damaging	Het
Ptk2	GA	G	15: 73,298,199		probably null	Het
Rb1cc1	C	A	1: 6,245,219	R473S	probably damaging	Het
Rcc2	G	A	4: 140,702,275	C40Y	probably benign	Het
Rdx	T	C	9: 52,065,646	V65A	probably damaging	Het
Rps6ka5	A	G	12: 100,573,796		probably null	Het
Samd5	C	T	10: 9,674,897	V23M	probably damaging	Het
Scn9a	T	G	2: 66,515,430	R1117S	probably benign	Het
Scrn1	T	A	6: 54,520,773	I278L	probably benign	Het
Sec31b	G	T	19: 44,519,365	P747T	probably damaging	Het
Slc2a13	T	C	15: 91,516,416	N201S	probably damaging	Het
Slc30a3	C	A	5: 31,090,051		probably benign	Het
Snx31	C	A	15: 36,523,460	V359F	probably damaging	Het
Sstr2	A	G	11: 113,624,273	E6G	probably benign	Het
Stc2	C	A	11: 31,367,806	E72*	probably null	Het
Tead1	C	T	7: 112,759,514	P11L	probably benign	Het
Tmem51	T	C	4: 142,031,748	T230A	probably damaging	Het
Tmem63c	A	T	12: 87,072,198	K301*	probably null	Het
Tns3	G	C	11: 8,492,773	A530G	probably benign	Het
Trat1	T	C	16: 48,742,237	D70G	probably damaging	Het
Trex1	T	A	9: 109,058,329	E198V	probably damaging	Het
Ttn	T	G	2: 76,739,728	R26940S	probably damaging	Het
Uba2	T	C	7: 34,168,410	K34R	possibly damaging	Het
Vps13d	A	C	4: 144,975,183	M4376R		Het
Zfp157	C	A	5: 138,456,074	T178K	probably damaging	Het
Zfp318	T	A	17: 46,399,766	V805D	possibly damaging	Het

Other mutations in Sipa1l2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00534:Sipa1l2	APN	8	125491806	missense	probably damaging	1.00
IGL00939:Sipa1l2	APN	8	125464435	splice site	probably benign
IGL00965:Sipa1l2	APN	8	125447874	missense	probably benign	0.02
IGL01321:Sipa1l2	APN	8	125491518	missense	probably damaging	1.00
IGL01450:Sipa1l2	APN	8	125422577	critical splice donor site	probably null
IGL01753:Sipa1l2	APN	8	125453292	splice site	probably benign
IGL01930:Sipa1l2	APN	8	125419239	missense	probably damaging	0.99
IGL02041:Sipa1l2	APN	8	125491819	missense	probably benign	0.03
IGL02215:Sipa1l2	APN	8	125447837	missense	possibly damaging	0.67
IGL02272:Sipa1l2	APN	8	125492011	missense	probably damaging	1.00
IGL02370:Sipa1l2	APN	8	125480269	missense	probably damaging	1.00
IGL02538:Sipa1l2	APN	8	125451977	missense	probably damaging	1.00
IGL02633:Sipa1l2	APN	8	125447768	missense	probably damaging	1.00
IGL03394:Sipa1l2	APN	8	125491659	missense	possibly damaging	0.67
Rebellious	UTSW	8	125468339	missense	probably benign	0.01
R0144:Sipa1l2	UTSW	8	125449876	splice site	probably null
R0153:Sipa1l2	UTSW	8	125421898	missense	probably damaging	0.99
R0276:Sipa1l2	UTSW	8	125421940	missense	probably damaging	1.00
R0318:Sipa1l2	UTSW	8	125447697	missense	possibly damaging	0.73
R0373:Sipa1l2	UTSW	8	125464410	missense	probably damaging	0.99
R0427:Sipa1l2	UTSW	8	125480332	missense	probably damaging	1.00
R0634:Sipa1l2	UTSW	8	125422624	nonsense	probably null
R1377:Sipa1l2	UTSW	8	125491977	missense	probably damaging	1.00
R1404:Sipa1l2	UTSW	8	125449973	missense	probably damaging	1.00
R1404:Sipa1l2	UTSW	8	125449973	missense	probably damaging	1.00
R1435:Sipa1l2	UTSW	8	125468725	missense	probably damaging	1.00
R1523:Sipa1l2	UTSW	8	125447613	missense	possibly damaging	0.75
R1577:Sipa1l2	UTSW	8	125492262	missense	probably benign	0.00
R1581:Sipa1l2	UTSW	8	125491617	missense	probably damaging	0.96
R1583:Sipa1l2	UTSW	8	125421895	missense	probably damaging	0.97
R1719:Sipa1l2	UTSW	8	125444535	missense	probably damaging	0.99
R1730:Sipa1l2	UTSW	8	125480141	splice site	probably null
R1940:Sipa1l2	UTSW	8	125480148	splice site	probably benign
R2007:Sipa1l2	UTSW	8	125439437	missense	probably damaging	1.00
R2141:Sipa1l2	UTSW	8	125491491	missense	probably benign	0.07
R2203:Sipa1l2	UTSW	8	125491627	missense	probably damaging	0.99
R2764:Sipa1l2	UTSW	8	125492374	missense	probably damaging	0.99
R3722:Sipa1l2	UTSW	8	125473584	missense	probably damaging	1.00
R3787:Sipa1l2	UTSW	8	125423205	missense	probably benign
R3787:Sipa1l2	UTSW	8	125450383	missense	possibly damaging	0.52
R4106:Sipa1l2	UTSW	8	125492308	missense	probably damaging	1.00
R4117:Sipa1l2	UTSW	8	125468510	missense	probably damaging	1.00
R4194:Sipa1l2	UTSW	8	125491672	missense	probably benign	0.00
R4237:Sipa1l2	UTSW	8	125491656	missense	probably benign	0.44
R4240:Sipa1l2	UTSW	8	125491656	missense	probably benign	0.44
R4448:Sipa1l2	UTSW	8	125492355	missense	probably damaging	1.00
R4515:Sipa1l2	UTSW	8	125492226	missense	probably benign	0.00
R4519:Sipa1l2	UTSW	8	125492226	missense	probably benign	0.00
R4523:Sipa1l2	UTSW	8	125492424	missense	probably damaging	1.00
R4557:Sipa1l2	UTSW	8	125464415	missense	probably damaging	0.98
R4667:Sipa1l2	UTSW	8	125453470	missense	possibly damaging	0.93
R4687:Sipa1l2	UTSW	8	125491245	missense	probably damaging	1.00
R4854:Sipa1l2	UTSW	8	125473601	missense	probably damaging	1.00
R4890:Sipa1l2	UTSW	8	125491867	missense	probably damaging	1.00
R5065:Sipa1l2	UTSW	8	125491585	missense	probably benign	0.19
R5194:Sipa1l2	UTSW	8	125439273	missense	possibly damaging	0.48
R5266:Sipa1l2	UTSW	8	125492126	missense	probably damaging	0.99
R5475:Sipa1l2	UTSW	8	125491595	missense	probably damaging	1.00
R5718:Sipa1l2	UTSW	8	125491248	missense	probably damaging	1.00
R5910:Sipa1l2	UTSW	8	125491684	missense	probably benign	0.42
R5916:Sipa1l2	UTSW	8	125468573	missense	probably damaging	1.00
R5941:Sipa1l2	UTSW	8	125473536	missense	probably damaging	0.99
R6083:Sipa1l2	UTSW	8	125468473	missense	possibly damaging	0.87
R6185:Sipa1l2	UTSW	8	125468253	nonsense	probably null
R6235:Sipa1l2	UTSW	8	125474871	missense	probably damaging	1.00
R6274:Sipa1l2	UTSW	8	125469872	missense	probably damaging	1.00
R6299:Sipa1l2	UTSW	8	125453464	missense	possibly damaging	0.75
R6374:Sipa1l2	UTSW	8	125444630	missense	probably damaging	1.00
R6459:Sipa1l2	UTSW	8	125444484	critical splice donor site	probably null
R6462:Sipa1l2	UTSW	8	125491230	missense	probably damaging	1.00
R6496:Sipa1l2	UTSW	8	125449894	missense	probably benign	0.00
R6543:Sipa1l2	UTSW	8	125450362	missense	possibly damaging	0.50
R7154:Sipa1l2	UTSW	8	125468339	missense	probably benign	0.01
R7192:Sipa1l2	UTSW	8	125422609	missense	probably benign	0.09
R7240:Sipa1l2	UTSW	8	125469860	missense	probably damaging	1.00
R7361:Sipa1l2	UTSW	8	125453332	missense	probably damaging	1.00
R7383:Sipa1l2	UTSW	8	125447646	missense	probably damaging	1.00
R7417:Sipa1l2	UTSW	8	125482106	missense	possibly damaging	0.93
R7604:Sipa1l2	UTSW	8	125419272	missense	probably benign	0.45
R7658:Sipa1l2	UTSW	8	125492290	missense	probably benign	0.00
R7743:Sipa1l2	UTSW	8	125464233	missense	probably damaging	1.00
R7781:Sipa1l2	UTSW	8	125491827	missense	possibly damaging	0.46
R7812:Sipa1l2	UTSW	8	125491595	missense	probably damaging	1.00
R7829:Sipa1l2	UTSW	8	125451988	missense	probably damaging	1.00
R7880:Sipa1l2	UTSW	8	125464393	missense	probably damaging	1.00
R7884:Sipa1l2	UTSW	8	125447598	missense	probably benign
R8082:Sipa1l2	UTSW	8	125491809	missense	possibly damaging	0.82
R8092:Sipa1l2	UTSW	8	125419168	missense	probably benign	0.03
R8247:Sipa1l2	UTSW	8	125422633	missense	probably benign	0.29
R8252:Sipa1l2	UTSW	8	125468671	missense	probably damaging	1.00
R8386:Sipa1l2	UTSW	8	125492093	missense	probably damaging	1.00
R8466:Sipa1l2	UTSW	8	125492246	missense	probably damaging	1.00
R8697:Sipa1l2	UTSW	8	125482116	missense	probably damaging	1.00
R8725:Sipa1l2	UTSW	8	125450386	missense	probably benign	0.28
R8727:Sipa1l2	UTSW	8	125450386	missense	probably benign	0.28
R9048:Sipa1l2	UTSW	8	125447726	missense	possibly damaging	0.59
R9224:Sipa1l2	UTSW	8	125491977	missense	probably damaging	1.00
R9279:Sipa1l2	UTSW	8	125482157	missense	probably damaging	1.00
R9392:Sipa1l2	UTSW	8	125468221	missense	probably benign
R9574:Sipa1l2	UTSW	8	125442714	missense	probably benign
R9591:Sipa1l2	UTSW	8	125492373	missense	probably damaging	0.99
R9614:Sipa1l2	UTSW	8	125469826	missense	probably null	0.01
R9690:Sipa1l2	UTSW	8	125492257	missense	probably benign
X0027:Sipa1l2	UTSW	8	125492136	missense	probably damaging	1.00
Z1177:Sipa1l2	UTSW	8	125447556	missense	possibly damaging	0.72

Predicted Primers

PCR Primer
(F):5'- CAGCATGATGAACTCATTGGAG -3'
(R):5'- TGGAGTCTCCAGGTCAAAGG -3'

Sequencing Primer
(F):5'- GCATGATGAACTCATTGGAGATCCC -3'
(R):5'- AGTCTCCAGGTCAAAGGATGTCC -3'

Posted On

2020-01-23